ID: 1158395116

View in Genome Browser
Species Human (GRCh38)
Location 18:57073218-57073240
Sequence CCTCAGCTTCCTCATCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395116_1158395121 15 Left 1158395116 18:57073218-57073240 CCTCCTGGATGAGGAAGCTGAGG No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395116 Original CRISPR CCTCAGCTTCCTCATCCAGG AGG (reversed) Intergenic