ID: 1158395118

View in Genome Browser
Species Human (GRCh38)
Location 18:57073221-57073243
Sequence CATCCTCAGCTTCCTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395118_1158395121 12 Left 1158395118 18:57073221-57073243 CCTGGATGAGGAAGCTGAGGATG No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG No data
1158395118_1158395123 29 Left 1158395118 18:57073221-57073243 CCTGGATGAGGAAGCTGAGGATG No data
Right 1158395123 18:57073273-57073295 CATTGGAGTGTCCTGAATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395118 Original CRISPR CATCCTCAGCTTCCTCATCC AGG (reversed) Intergenic