ID: 1158395119

View in Genome Browser
Species Human (GRCh38)
Location 18:57073224-57073246
Sequence GGATGAGGAAGCTGAGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395110_1158395119 2 Left 1158395110 18:57073199-57073221 CCTTCGCCCTGTCCTCTTACCTC No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data
1158395115_1158395119 -10 Left 1158395115 18:57073211-57073233 CCTCTTACCTCCTGGATGAGGAA No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data
1158395113_1158395119 -5 Left 1158395113 18:57073206-57073228 CCTGTCCTCTTACCTCCTGGATG No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data
1158395112_1158395119 -4 Left 1158395112 18:57073205-57073227 CCCTGTCCTCTTACCTCCTGGAT No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395119 Original CRISPR GGATGAGGAAGCTGAGGATG AGG Intergenic
No off target data available for this crispr