ID: 1158395121

View in Genome Browser
Species Human (GRCh38)
Location 18:57073256-57073278
Sequence TGACTCATGTCATGTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395118_1158395121 12 Left 1158395118 18:57073221-57073243 CCTGGATGAGGAAGCTGAGGATG No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 115
1158395113_1158395121 27 Left 1158395113 18:57073206-57073228 CCTGTCCTCTTACCTCCTGGATG No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 115
1158395115_1158395121 22 Left 1158395115 18:57073211-57073233 CCTCTTACCTCCTGGATGAGGAA No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 115
1158395112_1158395121 28 Left 1158395112 18:57073205-57073227 CCCTGTCCTCTTACCTCCTGGAT No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 115
1158395116_1158395121 15 Left 1158395116 18:57073218-57073240 CCTCCTGGATGAGGAAGCTGAGG No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395121 Original CRISPR TGACTCATGTCATGTTCCAT TGG Intergenic