ID: 1158401052

View in Genome Browser
Species Human (GRCh38)
Location 18:57121924-57121946
Sequence CGATCCCGCCTCGGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158401052_1158401066 21 Left 1158401052 18:57121924-57121946 CCTGGCCTCCCGAGGCGGGATCG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1158401066 18:57121968-57121990 GAGGATCCTGCCAGCCAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 205
1158401052_1158401061 -5 Left 1158401052 18:57121924-57121946 CCTGGCCTCCCGAGGCGGGATCG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1158401061 18:57121942-57121964 GATCGGGGCCGGGCTCCACTCGG 0: 1
1: 0
2: 0
3: 8
4: 68
1158401052_1158401062 2 Left 1158401052 18:57121924-57121946 CCTGGCCTCCCGAGGCGGGATCG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1158401062 18:57121949-57121971 GCCGGGCTCCACTCGGTGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 70
1158401052_1158401065 20 Left 1158401052 18:57121924-57121946 CCTGGCCTCCCGAGGCGGGATCG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1158401065 18:57121967-57121989 AGAGGATCCTGCCAGCCAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158401052 Original CRISPR CGATCCCGCCTCGGGAGGCC AGG (reversed) Intergenic
901651121 1:10743760-10743782 CGATCCCGTGACGGGAGGGCAGG + Intronic
902770684 1:18643845-18643867 CGACCCCGAGGCGGGAGGCCGGG + Intronic
904610206 1:31721630-31721652 CCCTACCGCCTTGGGAGGCCGGG - Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1062847701 10:720343-720365 CGTTCCCACCTCGGGTGTCCAGG + Intergenic
1067156006 10:43781954-43781976 GGATCCCTGCTCTGGAGGCCTGG - Intergenic
1067217490 10:44315286-44315308 CGAGCCAGCCTCAGGATGCCTGG + Intergenic
1073441541 10:103555455-103555477 CGAGACCGCCTGGGGAGGCCGGG + Intronic
1073571114 10:104581808-104581830 GGCTCCCACCTGGGGAGGCCTGG + Intergenic
1074065223 10:110007746-110007768 CGAGCGCCCCTCGGGAGTCCTGG - Intronic
1076692311 10:132230131-132230153 CGAGGCCGCCTTGGGAGGGCGGG + Intronic
1084296215 11:68214421-68214443 CGATCCCTCCTCGGGGATCCCGG + Intergenic
1089732347 11:120527163-120527185 TGATCCCGCCTCGGCTTGCCGGG + Intronic
1090877736 11:130805943-130805965 CAGTCCTGCCTTGGGAGGCCTGG + Intergenic
1096116814 12:49059966-49059988 CGAGCCCGGCGCGGGCGGCCGGG - Intergenic
1098769722 12:74537990-74538012 CGACCCCGCCGCCGGAGGACTGG + Exonic
1103726795 12:123001208-123001230 CGTCCCCACCTCGGGAAGCCAGG - Intronic
1113607725 13:111622316-111622338 CGATCCCCACTCGGTAGCCCAGG + Intronic
1117072588 14:52069557-52069579 CGCTCCTGGCTCTGGAGGCCTGG + Intergenic
1122075377 14:99231808-99231830 GGACCCCGCCTCTGGGGGCCTGG + Intronic
1142065020 16:88057398-88057420 CCATCCTTCCTCTGGAGGCCAGG - Intronic
1147627040 17:41906996-41907018 CGGTCTCGTCTGGGGAGGCCTGG - Intronic
1151702087 17:75748869-75748891 TGTTCCAGCCTGGGGAGGCCTGG + Exonic
1151761136 17:76103781-76103803 TGGTCCCGCCCCGGGACGCCTGG + Intronic
1158401052 18:57121924-57121946 CGATCCCGCCTCGGGAGGCCAGG - Intergenic
1158931084 18:62325463-62325485 CGACGCCTCCTCGGGAGCCCCGG + Intronic
1161477935 19:4496615-4496637 CGATCCCGCCTCCAGAGACACGG + Intronic
933772598 2:85753813-85753835 CGCTCGCGGCTCGGGCGGCCCGG + Intronic
943060434 2:183037744-183037766 CGATCCCGCCGCCGGGAGCCGGG + Intronic
948721938 2:239905995-239906017 TGATCCCACCACAGGAGGCCAGG - Intronic
949017188 2:241720146-241720168 CACTCCCGCCCCGGCAGGCCAGG - Intronic
1168904635 20:1393174-1393196 CGGTCCCTCTTCCGGAGGCCTGG - Intergenic
1172039086 20:32031266-32031288 CGCTCCCGCCCCTGGAGCCCCGG - Exonic
1172618907 20:36307022-36307044 GGATCCCGTCTCGGTAGACCCGG + Intronic
1183692942 22:39401285-39401307 CAATCCCCACTGGGGAGGCCTGG - Intronic
1184722779 22:46324923-46324945 CCATGGCCCCTCGGGAGGCCAGG - Intronic
956396589 3:68832779-68832801 AGATTCCGCCTCTGGAGGCAGGG - Intronic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
961366973 3:126406378-126406400 CCATCCCGCCCCAGGAGGACTGG + Intronic
961487617 3:127227692-127227714 CGCTCCCTCCTCGGGAGCCTTGG - Intergenic
965558363 3:170038971-170038993 CGAACCTGCCTCCGGAGGCCCGG - Exonic
994175117 5:96702719-96702741 CGGCCCCGCCCCGGGAGCCCGGG - Intronic
997598088 5:135120588-135120610 GGATCCTGCCTAGGGAGGTCAGG + Intronic
998265474 5:140664807-140664829 CGCTTCCGCCTCGGGGGGCGGGG - Exonic
1003307685 6:4944533-4944555 TGATCGCTCCTGGGGAGGCCTGG - Intronic
1007739138 6:44000509-44000531 CACTCCCGCCGCGGCAGGCCAGG + Intergenic
1019278362 7:187785-187807 GGATCCTGCCTGGGGAGACCTGG - Intergenic
1019889819 7:3937427-3937449 TGATCCCGCCTCTGCAGGCTGGG - Intronic
1020066849 7:5194946-5194968 CAAGCCCGCCTCTGGAGCCCTGG - Intronic
1029494351 7:100889226-100889248 CGATCCAGTCCCGGGAGCCCCGG + Exonic
1035158604 7:156934615-156934637 GGATCCCGCACTGGGAGGCCTGG + Intergenic
1039875184 8:41578591-41578613 CCCTCCCGCCCCGGGAGTCCGGG + Intronic
1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG + Intergenic
1049724174 8:144137856-144137878 CGCTGGCGCCTCGGGAGGGCCGG + Exonic
1061826739 9:133262535-133262557 CGAACCCACCGAGGGAGGCCAGG + Intronic
1185623126 X:1465489-1465511 CTCTCCTGCCTCTGGAGGCCGGG + Exonic