ID: 1158404807

View in Genome Browser
Species Human (GRCh38)
Location 18:57151619-57151641
Sequence GCACCCTGGTTTCCTGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158404807_1158404815 30 Left 1158404807 18:57151619-57151641 CCCCATGCAGGAAACCAGGGTGC No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data
1158404807_1158404812 -9 Left 1158404807 18:57151619-57151641 CCCCATGCAGGAAACCAGGGTGC No data
Right 1158404812 18:57151633-57151655 CCAGGGTGCACCTGAGGTTGAGG No data
1158404807_1158404814 19 Left 1158404807 18:57151619-57151641 CCCCATGCAGGAAACCAGGGTGC No data
Right 1158404814 18:57151661-57151683 TCAAACTTGAGTGAGCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158404807 Original CRISPR GCACCCTGGTTTCCTGCATG GGG (reversed) Intergenic
No off target data available for this crispr