ID: 1158404808

View in Genome Browser
Species Human (GRCh38)
Location 18:57151620-57151642
Sequence TGCACCCTGGTTTCCTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158404808_1158404815 29 Left 1158404808 18:57151620-57151642 CCCATGCAGGAAACCAGGGTGCA No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data
1158404808_1158404814 18 Left 1158404808 18:57151620-57151642 CCCATGCAGGAAACCAGGGTGCA No data
Right 1158404814 18:57151661-57151683 TCAAACTTGAGTGAGCATCAAGG No data
1158404808_1158404812 -10 Left 1158404808 18:57151620-57151642 CCCATGCAGGAAACCAGGGTGCA No data
Right 1158404812 18:57151633-57151655 CCAGGGTGCACCTGAGGTTGAGG No data
1158404808_1158404816 30 Left 1158404808 18:57151620-57151642 CCCATGCAGGAAACCAGGGTGCA No data
Right 1158404816 18:57151673-57151695 GAGCATCAAGGTTAACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158404808 Original CRISPR TGCACCCTGGTTTCCTGCAT GGG (reversed) Intergenic
No off target data available for this crispr