ID: 1158404812

View in Genome Browser
Species Human (GRCh38)
Location 18:57151633-57151655
Sequence CCAGGGTGCACCTGAGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158404808_1158404812 -10 Left 1158404808 18:57151620-57151642 CCCATGCAGGAAACCAGGGTGCA No data
Right 1158404812 18:57151633-57151655 CCAGGGTGCACCTGAGGTTGAGG No data
1158404807_1158404812 -9 Left 1158404807 18:57151619-57151641 CCCCATGCAGGAAACCAGGGTGC No data
Right 1158404812 18:57151633-57151655 CCAGGGTGCACCTGAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158404812 Original CRISPR CCAGGGTGCACCTGAGGTTG AGG Intergenic
No off target data available for this crispr