ID: 1158404815

View in Genome Browser
Species Human (GRCh38)
Location 18:57151672-57151694
Sequence TGAGCATCAAGGTTAACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158404813_1158404815 6 Left 1158404813 18:57151643-57151665 CCTGAGGTTGAGGACTTCTCAAA No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data
1158404811_1158404815 16 Left 1158404811 18:57151633-57151655 CCAGGGTGCACCTGAGGTTGAGG No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data
1158404809_1158404815 28 Left 1158404809 18:57151621-57151643 CCATGCAGGAAACCAGGGTGCAC No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data
1158404807_1158404815 30 Left 1158404807 18:57151619-57151641 CCCCATGCAGGAAACCAGGGTGC No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data
1158404808_1158404815 29 Left 1158404808 18:57151620-57151642 CCCATGCAGGAAACCAGGGTGCA No data
Right 1158404815 18:57151672-57151694 TGAGCATCAAGGTTAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158404815 Original CRISPR TGAGCATCAAGGTTAACCAG AGG Intergenic
No off target data available for this crispr