ID: 1158405456

View in Genome Browser
Species Human (GRCh38)
Location 18:57155771-57155793
Sequence CTTCCATCAAGGAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158405456_1158405464 27 Left 1158405456 18:57155771-57155793 CCTTCCAGCTTCCTTGATGGAAG No data
Right 1158405464 18:57155821-57155843 CATGTGTTTGGAGAGCTCCCTGG No data
1158405456_1158405461 15 Left 1158405456 18:57155771-57155793 CCTTCCAGCTTCCTTGATGGAAG No data
Right 1158405461 18:57155809-57155831 GCTTCCAGCCAGCATGTGTTTGG No data
1158405456_1158405465 28 Left 1158405456 18:57155771-57155793 CCTTCCAGCTTCCTTGATGGAAG No data
Right 1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG No data
1158405456_1158405460 -7 Left 1158405456 18:57155771-57155793 CCTTCCAGCTTCCTTGATGGAAG No data
Right 1158405460 18:57155787-57155809 ATGGAAGCAGGCTTCGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158405456 Original CRISPR CTTCCATCAAGGAAGCTGGA AGG (reversed) Intergenic