ID: 1158405457

View in Genome Browser
Species Human (GRCh38)
Location 18:57155775-57155797
Sequence CCTGCTTCCATCAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158405457_1158405466 27 Left 1158405457 18:57155775-57155797 CCAGCTTCCTTGATGGAAGCAGG No data
Right 1158405466 18:57155825-57155847 TGTTTGGAGAGCTCCCTGGGTGG No data
1158405457_1158405464 23 Left 1158405457 18:57155775-57155797 CCAGCTTCCTTGATGGAAGCAGG No data
Right 1158405464 18:57155821-57155843 CATGTGTTTGGAGAGCTCCCTGG No data
1158405457_1158405461 11 Left 1158405457 18:57155775-57155797 CCAGCTTCCTTGATGGAAGCAGG No data
Right 1158405461 18:57155809-57155831 GCTTCCAGCCAGCATGTGTTTGG No data
1158405457_1158405465 24 Left 1158405457 18:57155775-57155797 CCAGCTTCCTTGATGGAAGCAGG No data
Right 1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158405457 Original CRISPR CCTGCTTCCATCAAGGAAGC TGG (reversed) Intergenic