ID: 1158405459

View in Genome Browser
Species Human (GRCh38)
Location 18:57155782-57155804
Sequence TGCGAAGCCTGCTTCCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158405459_1158405465 17 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG No data
1158405459_1158405464 16 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405464 18:57155821-57155843 CATGTGTTTGGAGAGCTCCCTGG No data
1158405459_1158405461 4 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405461 18:57155809-57155831 GCTTCCAGCCAGCATGTGTTTGG No data
1158405459_1158405466 20 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405466 18:57155825-57155847 TGTTTGGAGAGCTCCCTGGGTGG No data
1158405459_1158405467 28 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405467 18:57155833-57155855 GAGCTCCCTGGGTGGTGAACAGG No data
1158405459_1158405468 29 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405468 18:57155834-57155856 AGCTCCCTGGGTGGTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158405459 Original CRISPR TGCGAAGCCTGCTTCCATCA AGG (reversed) Intergenic