ID: 1158405465

View in Genome Browser
Species Human (GRCh38)
Location 18:57155822-57155844
Sequence ATGTGTTTGGAGAGCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158405459_1158405465 17 Left 1158405459 18:57155782-57155804 CCTTGATGGAAGCAGGCTTCGCA No data
Right 1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG No data
1158405457_1158405465 24 Left 1158405457 18:57155775-57155797 CCAGCTTCCTTGATGGAAGCAGG No data
Right 1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG No data
1158405456_1158405465 28 Left 1158405456 18:57155771-57155793 CCTTCCAGCTTCCTTGATGGAAG No data
Right 1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158405465 Original CRISPR ATGTGTTTGGAGAGCTCCCT GGG Intergenic