ID: 1158406262

View in Genome Browser
Species Human (GRCh38)
Location 18:57162319-57162341
Sequence CAGAAATTCCTCAATAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158406262_1158406264 -10 Left 1158406262 18:57162319-57162341 CCTTGTTTATTGAGGAATTTCTG No data
Right 1158406264 18:57162332-57162354 GGAATTTCTGAGTGTACCGGAGG No data
1158406262_1158406265 4 Left 1158406262 18:57162319-57162341 CCTTGTTTATTGAGGAATTTCTG No data
Right 1158406265 18:57162346-57162368 TACCGGAGGAATCACAACCCAGG No data
1158406262_1158406266 5 Left 1158406262 18:57162319-57162341 CCTTGTTTATTGAGGAATTTCTG No data
Right 1158406266 18:57162347-57162369 ACCGGAGGAATCACAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158406262 Original CRISPR CAGAAATTCCTCAATAAACA AGG (reversed) Intergenic
No off target data available for this crispr