ID: 1158407814

View in Genome Browser
Species Human (GRCh38)
Location 18:57175899-57175921
Sequence ACTCCTGGCCCCAGTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158407814_1158407819 -7 Left 1158407814 18:57175899-57175921 CCCAACCCACTGGGGCCAGGAGT No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158407814 Original CRISPR ACTCCTGGCCCCAGTGGGTT GGG (reversed) Intergenic
No off target data available for this crispr