ID: 1158407819

View in Genome Browser
Species Human (GRCh38)
Location 18:57175915-57175937
Sequence CAGGAGTTTAGCAGCTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158407809_1158407819 7 Left 1158407809 18:57175885-57175907 CCTCAGAGATGCTACCCAACCCA No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data
1158407807_1158407819 24 Left 1158407807 18:57175868-57175890 CCCTGGGAGTGGTGATTCCTCAG No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data
1158407808_1158407819 23 Left 1158407808 18:57175869-57175891 CCTGGGAGTGGTGATTCCTCAGA No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data
1158407806_1158407819 25 Left 1158407806 18:57175867-57175889 CCCCTGGGAGTGGTGATTCCTCA No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data
1158407805_1158407819 30 Left 1158407805 18:57175862-57175884 CCTGTCCCCTGGGAGTGGTGATT No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data
1158407814_1158407819 -7 Left 1158407814 18:57175899-57175921 CCCAACCCACTGGGGCCAGGAGT No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data
1158407815_1158407819 -8 Left 1158407815 18:57175900-57175922 CCAACCCACTGGGGCCAGGAGTT No data
Right 1158407819 18:57175915-57175937 CAGGAGTTTAGCAGCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158407819 Original CRISPR CAGGAGTTTAGCAGCTGTCT AGG Intergenic
No off target data available for this crispr