ID: 1158410425

View in Genome Browser
Species Human (GRCh38)
Location 18:57200346-57200368
Sequence GGTCCCAGTAGACCAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158410425_1158410429 8 Left 1158410425 18:57200346-57200368 CCTTCCTTTGGTCTACTGGGACC No data
Right 1158410429 18:57200377-57200399 GAGCAAACTCCCAATCACGAAGG No data
1158410425_1158410433 19 Left 1158410425 18:57200346-57200368 CCTTCCTTTGGTCTACTGGGACC No data
Right 1158410433 18:57200388-57200410 CAATCACGAAGGCAGCTGGACGG No data
1158410425_1158410430 15 Left 1158410425 18:57200346-57200368 CCTTCCTTTGGTCTACTGGGACC No data
Right 1158410430 18:57200384-57200406 CTCCCAATCACGAAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158410425 Original CRISPR GGTCCCAGTAGACCAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr