ID: 1158417075

View in Genome Browser
Species Human (GRCh38)
Location 18:57257879-57257901
Sequence GGAGCCAGATGCAGTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158417074_1158417075 -6 Left 1158417074 18:57257862-57257884 CCAACAACTATGCTTCAGGAGCC No data
Right 1158417075 18:57257879-57257901 GGAGCCAGATGCAGTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158417075 Original CRISPR GGAGCCAGATGCAGTCCTAC AGG Intergenic