ID: 1158417075 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:57257879-57257901 |
| Sequence | GGAGCCAGATGCAGTCCTAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1158417074_1158417075 | -6 | Left | 1158417074 | 18:57257862-57257884 | CCAACAACTATGCTTCAGGAGCC | No data | ||
| Right | 1158417075 | 18:57257879-57257901 | GGAGCCAGATGCAGTCCTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1158417075 | Original CRISPR | GGAGCCAGATGCAGTCCTAC AGG | Intergenic | ||