ID: 1158418999

View in Genome Browser
Species Human (GRCh38)
Location 18:57275988-57276010
Sequence TGTGATGTGAAGGAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158418999_1158419004 8 Left 1158418999 18:57275988-57276010 CCTTCTACCTCCTTCACATCACA No data
Right 1158419004 18:57276019-57276041 CATTTATCTCTTTCAAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158418999 Original CRISPR TGTGATGTGAAGGAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr