ID: 1158420602

View in Genome Browser
Species Human (GRCh38)
Location 18:57289918-57289940
Sequence CTGCTTTGTAACTGAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158420602_1158420604 -4 Left 1158420602 18:57289918-57289940 CCTGAATTTCAGTTACAAAGCAG No data
Right 1158420604 18:57289937-57289959 GCAGGAAACTGTGCAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158420602 Original CRISPR CTGCTTTGTAACTGAAATTC AGG (reversed) Intergenic
No off target data available for this crispr