ID: 1158421616

View in Genome Browser
Species Human (GRCh38)
Location 18:57299792-57299814
Sequence TCTCTCTGCAGCTTCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158421616_1158421621 13 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421621 18:57299828-57299850 ACCAAAGTTGGACATGGACAAGG No data
1158421616_1158421620 7 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421620 18:57299822-57299844 TTGGAGACCAAAGTTGGACATGG No data
1158421616_1158421624 26 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG No data
1158421616_1158421626 30 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421626 18:57299845-57299867 ACAAGGAGACTGAGGTAGGGAGG No data
1158421616_1158421623 22 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421623 18:57299837-57299859 GGACATGGACAAGGAGACTGAGG No data
1158421616_1158421618 1 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421618 18:57299816-57299838 GCCATGTTGGAGACCAAAGTTGG No data
1158421616_1158421625 27 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421625 18:57299842-57299864 TGGACAAGGAGACTGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158421616 Original CRISPR TCTCTCTGCAGCTTCACACC TGG (reversed) Intergenic
No off target data available for this crispr