ID: 1158421619

View in Genome Browser
Species Human (GRCh38)
Location 18:57299817-57299839
Sequence TCCAACTTTGGTCTCCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158421619_1158421626 5 Left 1158421619 18:57299817-57299839 CCATGTTGGAGACCAAAGTTGGA No data
Right 1158421626 18:57299845-57299867 ACAAGGAGACTGAGGTAGGGAGG No data
1158421619_1158421625 2 Left 1158421619 18:57299817-57299839 CCATGTTGGAGACCAAAGTTGGA No data
Right 1158421625 18:57299842-57299864 TGGACAAGGAGACTGAGGTAGGG No data
1158421619_1158421624 1 Left 1158421619 18:57299817-57299839 CCATGTTGGAGACCAAAGTTGGA No data
Right 1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG No data
1158421619_1158421623 -3 Left 1158421619 18:57299817-57299839 CCATGTTGGAGACCAAAGTTGGA No data
Right 1158421623 18:57299837-57299859 GGACATGGACAAGGAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158421619 Original CRISPR TCCAACTTTGGTCTCCAACA TGG (reversed) Intergenic
No off target data available for this crispr