ID: 1158421624

View in Genome Browser
Species Human (GRCh38)
Location 18:57299841-57299863
Sequence ATGGACAAGGAGACTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158421619_1158421624 1 Left 1158421619 18:57299817-57299839 CCATGTTGGAGACCAAAGTTGGA No data
Right 1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG No data
1158421616_1158421624 26 Left 1158421616 18:57299792-57299814 CCAGGTGTGAAGCTGCAGAGAGA No data
Right 1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158421624 Original CRISPR ATGGACAAGGAGACTGAGGT AGG Intergenic
No off target data available for this crispr