ID: 1158425299

View in Genome Browser
Species Human (GRCh38)
Location 18:57334587-57334609
Sequence CAGCAAGCACAGAAGGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158425299_1158425307 29 Left 1158425299 18:57334587-57334609 CCCCGCACCTTCTGTGCTTGCTG No data
Right 1158425307 18:57334639-57334661 ACTGTTTCCAGTCCTCAGCCTGG No data
1158425299_1158425308 30 Left 1158425299 18:57334587-57334609 CCCCGCACCTTCTGTGCTTGCTG No data
Right 1158425308 18:57334640-57334662 CTGTTTCCAGTCCTCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158425299 Original CRISPR CAGCAAGCACAGAAGGTGCG GGG (reversed) Intergenic
No off target data available for this crispr