ID: 1158428977

View in Genome Browser
Species Human (GRCh38)
Location 18:57366561-57366583
Sequence CCTTTGCAGGCACTGTTTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158428977_1158428983 -5 Left 1158428977 18:57366561-57366583 CCACAAAACAGTGCCTGCAAAGG 0: 1
1: 0
2: 2
3: 11
4: 196
Right 1158428983 18:57366579-57366601 AAAGGAGCAGGGGAAGAACAAGG 0: 1
1: 0
2: 10
3: 97
4: 985
1158428977_1158428987 29 Left 1158428977 18:57366561-57366583 CCACAAAACAGTGCCTGCAAAGG 0: 1
1: 0
2: 2
3: 11
4: 196
Right 1158428987 18:57366613-57366635 CTCACTTGGCTCTACATATCTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1158428977_1158428984 15 Left 1158428977 18:57366561-57366583 CCACAAAACAGTGCCTGCAAAGG 0: 1
1: 0
2: 2
3: 11
4: 196
Right 1158428984 18:57366599-57366621 AGGCACCCAGTAAGCTCACTTGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158428977 Original CRISPR CCTTTGCAGGCACTGTTTTG TGG (reversed) Exonic
903801364 1:25970915-25970937 CCTTTGGAGTCGCTGTTTTTTGG - Intronic
906294031 1:44638093-44638115 CTTTTGCAGACAGGGTTTTGGGG - Intronic
907061637 1:51432226-51432248 CATTTGCTTGTACTGTTTTGTGG - Intronic
912265768 1:108156113-108156135 ACTTTCCTGGCACTGTTATGTGG - Intronic
915321820 1:155060656-155060678 CCTTTGCAGGCACTTATGTGTGG - Intronic
917336999 1:173934722-173934744 CATTTGAATGCTCTGTTTTGAGG + Exonic
918574767 1:186044397-186044419 CACTTTCATGCACTGTTTTGGGG - Intronic
919477473 1:198046860-198046882 CCTTTTCTTGCACTCTTTTGAGG + Intergenic
920748154 1:208648507-208648529 CCTTGACAGGCACAGCTTTGTGG + Intergenic
922580256 1:226691976-226691998 CCTTTGTAGGCACCCATTTGGGG - Intronic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
1063191604 10:3699785-3699807 CCTTTGCAAGATCTGTTTTGGGG + Intergenic
1063988232 10:11530949-11530971 CGTTTGCAGTCACTGTTTTGGGG - Intronic
1064405111 10:15054728-15054750 ACTTTGCATCCACTGTGTTGTGG + Intronic
1067175653 10:43943739-43943761 CCTTTGGAGGCACTTTCTTTAGG + Intergenic
1068633634 10:59324015-59324037 CACTTGAAGGCATTGTTTTGTGG + Exonic
1070311276 10:75275801-75275823 CCTTTGCACGGCCTGCTTTGGGG - Intergenic
1073538114 10:104296119-104296141 AATTTGCAGGTACTTTTTTGGGG + Intronic
1075410685 10:122225829-122225851 CCGTTGCAGGGACTTATTTGGGG + Intronic
1075424190 10:122328650-122328672 CCTATGCAGGCTCTGCCTTGAGG + Intronic
1076029685 10:127147002-127147024 TCTTTGCACCCTCTGTTTTGTGG + Intronic
1076218113 10:128711840-128711862 CCTCTGCAGGCACCTTTTGGTGG - Intergenic
1076746730 10:132518262-132518284 CCTGGACAGGCACTGTTCTGGGG + Intergenic
1076997195 11:303874-303896 CCTTTGAGGGCACAGTTTGGAGG + Intergenic
1078237636 11:9500949-9500971 CCCTTTCAGGCATTTTTTTGGGG - Intronic
1078962482 11:16293867-16293889 CCTCTGCTTGCACTGTTCTGAGG + Intronic
1080081934 11:28231098-28231120 CAATTCCAGACACTGTTTTGGGG + Intronic
1080585015 11:33674164-33674186 CCCCAACAGGCACTGTTTTGTGG - Intergenic
1081729932 11:45364270-45364292 CCTTGGCAGGGACTGTTCTCAGG + Intergenic
1083298090 11:61725986-61726008 GCTTTGCAGGCACCGCTTAGAGG + Exonic
1084067650 11:66714559-66714581 CCCTTGCACCCAGTGTTTTGTGG - Intronic
1084784469 11:71434194-71434216 CCTTTGCTGGGGCTGTTTTTGGG - Intronic
1085985466 11:81781870-81781892 CTTTTGCAGATGCTGTTTTGGGG + Intergenic
1087152370 11:94870219-94870241 CCTTTTCAGGAATTCTTTTGAGG + Intronic
1087619883 11:100528943-100528965 CCTTTGCTGGCACTGTCTGCAGG + Intergenic
1090529414 11:127575203-127575225 GCATTGAAGGCACTGTTTTAAGG - Intergenic
1090677164 11:129009636-129009658 CCTTTGCAGGGACATGTTTGGGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1091852848 12:3714208-3714230 TCTGTGCAGGCACTTTTTTTAGG + Intronic
1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG + Exonic
1093565779 12:20601481-20601503 CCTTTGAACACACTGTTTTGTGG - Intronic
1094228002 12:28067842-28067864 CCTTTGCAGCTGCTGTTTGGTGG - Intergenic
1095734070 12:45537137-45537159 CGCATGCAGGCACTGTTCTGGGG - Intergenic
1095897890 12:47299249-47299271 CCTGTGTATGCACTGTTTAGTGG + Intergenic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1102182477 12:110922938-110922960 CCTTTGCAGACTCTGCTTGGAGG - Intergenic
1102638624 12:114346625-114346647 CCTTTGGAGGGACAGTTTGGAGG - Intergenic
1104573236 12:129943857-129943879 TCTTGGTAGGAACTGTTTTGAGG - Intergenic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1107500318 13:40967126-40967148 CCTATGAAGACACTGCTTTGAGG + Intronic
1107886375 13:44877389-44877411 CCTTAATAGGCCCTGTTTTGGGG + Intergenic
1109856460 13:68134608-68134630 CCTTTGCAGATTCTCTTTTGTGG - Intergenic
1113034197 13:106030986-106031008 CTTTTTCAGGGACTGTTTTGTGG - Intergenic
1113975839 13:114226680-114226702 CCATTTCAGCCACTGTTTTGAGG - Intergenic
1116183983 14:41572744-41572766 CCTTACCTGGCACTATTTTGTGG - Intergenic
1120955580 14:90079209-90079231 CCTTTTGAGGCACTGTCTTTGGG + Intronic
1121176945 14:91897576-91897598 ACTTGGCAGGCACAGTTGTGTGG - Intronic
1124891633 15:33739037-33739059 TCTTTGCAAGCACTCATTTGAGG + Intronic
1126401804 15:48279152-48279174 CATTTCCATGCATTGTTTTGAGG + Intronic
1128530476 15:68441796-68441818 CATTTGCAGAGCCTGTTTTGAGG - Intergenic
1131152999 15:90058582-90058604 CCTCTGCAGTCACTGTCCTGTGG + Intronic
1132238061 15:100236892-100236914 CCATTCCTGGCTCTGTTTTGGGG - Intronic
1132729699 16:1355416-1355438 CCTTGGCAGACACTCTTCTGCGG - Intronic
1138269503 16:55685056-55685078 CATTTGCAGGGACTGGTCTGTGG + Intronic
1138573151 16:57888953-57888975 CCTTTGCAGGCACCCTTCAGTGG + Intronic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1141944851 16:87303062-87303084 GCTTTCCAGCCAGTGTTTTGGGG - Exonic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143496561 17:7315858-7315880 CCTCTTCATGCACTGATTTGGGG - Exonic
1149489810 17:57076113-57076135 CATTCACAGGCAATGTTTTGTGG + Intergenic
1150578422 17:66450673-66450695 TCTTTGCAGGGACAGTTTTGGGG + Intronic
1150946529 17:69752056-69752078 TCTTTGAATCCACTGTTTTGTGG + Intergenic
1152542784 17:80984918-80984940 CCTTTGTAAGGAATGTTTTGGGG - Intergenic
1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG + Intergenic
1158302325 18:56065797-56065819 CCTTAGAAGTCACTGTTTTCAGG - Intergenic
1158404740 18:57151250-57151272 CCTTTGCAGGAAATGATTTCTGG + Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1162719764 19:12655506-12655528 CCTTTCCTGGGACTGTTATGAGG - Intronic
1164586320 19:29478290-29478312 CCTTTGGAGGGACAATTTTGAGG + Intergenic
925078454 2:1040107-1040129 CCTTTCCAGGCACGCTTGTGGGG + Intronic
925787841 2:7450301-7450323 CATTTGTAGGCAATCTTTTGGGG - Intergenic
925919169 2:8627527-8627549 CCCTTGCAGGCAGGGTTCTGAGG - Intergenic
928330312 2:30352762-30352784 CCATTGCAGACACTCTATTGAGG + Intergenic
935035943 2:99373458-99373480 TCTTTGAAGGCACTTTTCTGCGG + Intronic
936047420 2:109198191-109198213 CCTATGCAGGCCATGTCTTGAGG - Intronic
937135195 2:119545621-119545643 CATTTGGAGGCACTGTTTACAGG - Intronic
938900394 2:135794534-135794556 GCGTTGGAGGCCCTGTTTTGAGG + Intronic
940779649 2:157919167-157919189 CCCTTGCAAGCTCTGTCTTGAGG - Intronic
941399568 2:165014109-165014131 CCTTAGCAGGCATAGTTGTGTGG - Intergenic
942586888 2:177490028-177490050 CTTTTGAAGGCAATCTTTTGTGG + Intronic
942828513 2:180210073-180210095 CCTTCTCTGGCACTGGTTTGGGG + Intergenic
943836586 2:192521744-192521766 ACTTTCTAGGCACTGATTTGGGG - Intergenic
944082158 2:195800051-195800073 CCTTTTCAGGCCTTGATTTGGGG + Intronic
944304588 2:198165021-198165043 TCGTTTCAGGCACTGATTTGCGG + Intronic
944468367 2:200026453-200026475 CCTTTGGAGGAACAGTTTTCTGG + Intergenic
948393212 2:237627266-237627288 ACTTTGCGGGGACTGTTTGGCGG - Intergenic
948648730 2:239425681-239425703 CCTTTGGATGCCATGTTTTGGGG - Intergenic
948890947 2:240906868-240906890 CCCTTGCAGCCACAGGTTTGCGG + Intergenic
1169020789 20:2329388-2329410 CATTTGGAGGCACAGTTTTAGGG + Intronic
1171558090 20:26096379-26096401 GCTTTGGAGGCACTGTGGTGGGG - Intergenic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1173008916 20:39163505-39163527 CCTTTTGGAGCACTGTTTTGGGG + Intergenic
1173384576 20:42575607-42575629 GCTTTGCAGGCTCTGTTTATTGG + Intronic
1173633390 20:44533137-44533159 ACTTTGCAGGCATTCATTTGTGG + Intronic
1173660099 20:44727287-44727309 CTCTAGAAGGCACTGTTTTGTGG - Exonic
1173797775 20:45874571-45874593 ACTTTTCAGGGAATGTTTTGGGG - Intronic
1173934503 20:46849641-46849663 CTTTTGCTGGCACTATTGTGAGG - Intergenic
1174705096 20:52647224-52647246 CCTCTTCCGCCACTGTTTTGTGG - Intergenic
1176524875 21:7858398-7858420 CTTTTGCACCCACTGTTTGGTGG + Intergenic
1177640676 21:23840620-23840642 CCATTGCAGGAGCTGTTTTCTGG - Intergenic
1178658895 21:34488411-34488433 CTTTTGCACCCACTGTTTGGTGG + Intergenic
1178815365 21:35924311-35924333 CCTTTGCAGTCACTGAGTTTTGG + Intronic
1178943079 21:36923625-36923647 ACTCTGCAGGCGCTGCTTTGAGG + Intronic
1179148408 21:38789296-38789318 CCTTAGCAGGCACTTGTTTTTGG + Intergenic
1184003698 22:41693733-41693755 GCTTTCCAGGAACTGTTCTGAGG - Exonic
1184056259 22:42052207-42052229 CCTCTCCAGGGACTGTCTTGAGG + Intronic
949099152 3:122647-122669 CCTTTGGAGGCAATGTTATAGGG + Intergenic
950828805 3:15854146-15854168 CCTTCGCAGGCCCTATTTTAAGG + Intronic
952602323 3:35100402-35100424 CCTTTGCTGGCACAGAATTGTGG - Intergenic
954466206 3:50656484-50656506 GCTTTGCATCCACCGTTTTGTGG - Intergenic
955653370 3:61218365-61218387 ACTCAGCAGGAACTGTTTTGTGG + Intronic
962099122 3:132323336-132323358 ATGTTCCAGGCACTGTTTTGGGG + Intronic
968740924 4:2331333-2331355 CCTTTAAAGGAACTGTTTTAAGG + Intronic
969696091 4:8735678-8735700 CCTGTGTAGGCACAGTTCTGTGG - Intergenic
969877649 4:10147754-10147776 CATTTGATGGGACTGTTTTGAGG - Intergenic
970208947 4:13687436-13687458 CCTTTGCAGGTATTATTTGGTGG + Intergenic
971908233 4:32757670-32757692 TCTTTGGAGGAAATGTTTTGAGG - Intergenic
973177019 4:47219591-47219613 CCTTTTCAGTCACTGTTCTTTGG + Intronic
974270405 4:59643996-59644018 CTTTTTCAGGCACTTATTTGGGG + Intergenic
975363227 4:73496547-73496569 CATTTCCAAGCACTGTTGTGGGG - Intronic
976151191 4:82093664-82093686 ACTTTGCATGCAGTTTTTTGGGG - Intergenic
977725132 4:100287820-100287842 CAAATGCAGGCAGTGTTTTGTGG + Intergenic
978299881 4:107255884-107255906 CTTTTGCAGGCACAGCCTTGTGG - Intronic
978650658 4:111000346-111000368 GATTTGCAGTCACTGATTTGGGG - Intergenic
980716541 4:136636820-136636842 CCTTTGCAGGGAGTGTGATGGGG - Intergenic
980973536 4:139588894-139588916 CATATGAAGGCACTGTGTTGGGG + Intronic
982800614 4:159702197-159702219 CCTTTGCAGGTATTCTTTGGTGG + Intergenic
983238248 4:165204594-165204616 CCATTTCAGGAACTCTTTTGAGG - Intronic
983258936 4:165433968-165433990 CCTTTGCACGAGCTGTTTTACGG + Intronic
984550172 4:181149965-181149987 CCACCTCAGGCACTGTTTTGGGG + Intergenic
985167281 4:187110135-187110157 CCTTTGTTGGCATTTTTTTGAGG - Intergenic
987118934 5:14748394-14748416 CCTGTCCAGGCACTGCCTTGAGG - Intronic
987270724 5:16305767-16305789 TGTTTGCATGCAGTGTTTTGGGG - Intergenic
987459564 5:18192138-18192160 CCTTTGCAGGTATTCTTTGGTGG + Intergenic
988731337 5:33976100-33976122 GCCTTGAAGCCACTGTTTTGTGG + Intronic
989196248 5:38719512-38719534 CTTTTGGAGGCATTGTTGTGGGG - Intergenic
989839788 5:46048655-46048677 AGTTTGGAGACACTGTTTTGTGG + Intergenic
990337730 5:54791819-54791841 CCTTTGCTGGGACTGCATTGTGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
994175519 5:96706756-96706778 CCTTTGCATGTGCTGTTTTGTGG + Intronic
997971771 5:138408996-138409018 CCTTTTCAGACTTTGTTTTGTGG - Intronic
998585548 5:143422853-143422875 TCATTCCAGGCACTGTTTTAAGG - Intronic
999092788 5:148952265-148952287 CCTTTGATGGCACTGCTTTCAGG + Intronic
1002284398 5:178152761-178152783 CTTTTTCAGGCACTGTGTTATGG - Intronic
1002936780 6:1680765-1680787 CCTTTGCAGTCATCTTTTTGTGG - Intronic
1005521230 6:26602290-26602312 CATTTGCAGGCAATGTGCTGGGG - Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1008209766 6:48706170-48706192 CCTTTCCGGGCAAAGTTTTGAGG + Intergenic
1013454962 6:110322292-110322314 GCTTTGCAGGCAGTGTGCTGAGG - Intronic
1015704359 6:136072002-136072024 CCTTTTAAGGCACTGTTGTAGGG - Intronic
1015768036 6:136739673-136739695 CATTTGCAGTCACTATTTTGGGG + Intronic
1016497738 6:144683353-144683375 CCTTTGCAGGGACTGTTTCAGGG + Intronic
1016497790 6:144683825-144683847 CCTTTTCAGCCAGTGTTTTCTGG - Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1017512835 6:155129769-155129791 CCTCTGCAGGCACTTTGCTGGGG - Exonic
1018070067 6:160156583-160156605 CCTTTACAGGCTCAGTTCTGTGG + Intronic
1018323095 6:162634226-162634248 CCTTTGCAGACAATGTTTGCTGG - Intronic
1022766741 7:33420965-33420987 CCTCTCTAGACACTGTTTTGTGG + Intronic
1023682087 7:42697539-42697561 CCTTTCCAAGCTCTGTCTTGTGG - Intergenic
1023727578 7:43160123-43160145 CCTTTGCACTTACTGATTTGTGG + Intronic
1023805010 7:43866719-43866741 CCTTTGAGGGCACAGTTTGGAGG + Exonic
1024959498 7:54959709-54959731 CATCTGCAGGCACTGCTTTCAGG - Intergenic
1024997769 7:55286914-55286936 CCTTGGCAGACACTTGTTTGAGG + Intergenic
1026456818 7:70580062-70580084 CGTTCGAAGGCACTGTGTTGTGG - Intronic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1029090404 7:98043698-98043720 CCTTCTCATGCTCTGTTTTGGGG - Intergenic
1030496364 7:110305898-110305920 TATTTCCAGGCTCTGTTTTGGGG - Intergenic
1033578747 7:142712300-142712322 CCTTTCCCGGCAGTGTTTAGAGG - Intergenic
1034098674 7:148432904-148432926 CCTTTGCAGGAACTTCTCTGGGG - Intergenic
1035708226 8:1693973-1693995 CCTAGGCAGGCACTGTCTTTAGG + Intronic
1037859917 8:22397914-22397936 CCTTTGTAGTTACTGTCTTGTGG + Intronic
1039364723 8:36917766-36917788 GCTGTGCATGCCCTGTTTTGGGG + Intronic
1043963763 8:86448139-86448161 TCTTTGCAGGCACTATTTCATGG + Exonic
1044097457 8:88085435-88085457 ATTTTGCAGGCACGGTTTTCAGG + Intronic
1044411599 8:91890064-91890086 CCTCTGCAGGAACTGTTTAGAGG - Intergenic
1049428179 8:142546757-142546779 CCTTCGCAGGCAGGGTTGTGTGG - Intergenic
1049602985 8:143516602-143516624 CCTCTGCAGTCTCTGTTGTGGGG - Intronic
1050299150 9:4239149-4239171 CATGTGCATGCACTGTTGTGGGG + Intronic
1051416671 9:16848591-16848613 CCTTAGCAGGCCTTGTTTTCAGG - Intronic
1051486758 9:17616973-17616995 CATTTGCAGGAACTGTCTTTAGG - Intronic
1052936537 9:34098015-34098037 CCTTTGCAGGTGCTGTATTCTGG - Intronic
1054338829 9:63835250-63835272 CCTTAGCAGGGAATGTTTTCAGG - Intergenic
1054791206 9:69258671-69258693 CCTTTGCAGTCACTAGTGTGGGG - Intergenic
1056461438 9:86813042-86813064 ACTTTTCAGGCATTGTTCTGTGG - Intergenic
1057749021 9:97775516-97775538 ACTTTGCAGTAATTGTTTTGTGG - Intergenic
1060507626 9:124209787-124209809 CCTTTTGAGGCTTTGTTTTGGGG + Intergenic
1060815658 9:126633786-126633808 CCTGTGCAGCCACTGATTTAAGG + Intronic
1060975639 9:127763385-127763407 CTCCTGCAGGCACTGTGTTGGGG - Intronic
1189287178 X:39860137-39860159 CCTTCACAGGACCTGTTTTGAGG + Intergenic
1192453032 X:71254950-71254972 GCTTTGCAGGACCTGGTTTGGGG - Intronic
1192639381 X:72847743-72847765 CCCTTGCAAGCTGTGTTTTGTGG + Intronic
1192642330 X:72873062-72873084 CCCTTGCAAGCTGTGTTTTGTGG - Intronic
1192789986 X:74372047-74372069 ACTTTGCTGGCACTGACTTGTGG - Intergenic
1195112221 X:101659521-101659543 CCTTTCCAGCCAGTGTTTTTTGG - Intronic
1196812290 X:119638290-119638312 CCTTTGCTTGCACTCTTTTGAGG - Intronic
1198673863 X:139110944-139110966 CCTTTGGAGGGCCAGTTTTGTGG + Intronic
1199092892 X:143712449-143712471 CTTTTGCAAGCTCTGTTTGGGGG + Exonic
1200327776 X:155260575-155260597 CCAGGCCAGGCACTGTTTTGTGG - Exonic
1200567726 Y:4787429-4787451 TCTTTGCTGGCACTGAGTTGGGG - Intergenic