ID: 1158429239

View in Genome Browser
Species Human (GRCh38)
Location 18:57369353-57369375
Sequence CAGAGGAAGGAGAACTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 545}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158429239_1158429243 -2 Left 1158429239 18:57369353-57369375 CCTGTCCAGTTCTCCTTCCTCTG 0: 1
1: 0
2: 5
3: 65
4: 545
Right 1158429243 18:57369374-57369396 TGTACCTTTCACCCCATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158429239 Original CRISPR CAGAGGAAGGAGAACTGGAC AGG (reversed) Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
901470486 1:9452639-9452661 CAGTGGAAGGAGCGCTGGACAGG + Intergenic
901738149 1:11325282-11325304 CAGAGGGTGGAGCACTGTACAGG + Intergenic
901745858 1:11373040-11373062 GATTGGAAGGAGCACTGGACGGG + Intergenic
901762821 1:11481546-11481568 TGGTGGAAGGAGCACTGGACTGG + Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902221933 1:14971907-14971929 CAGGGGAAGGAGGACGAGACTGG - Intronic
903454933 1:23481026-23481048 AAAAGGAAAGAGAACAGGACCGG + Intronic
903604394 1:24564801-24564823 CAGAGGAACAAGAACTGGGTTGG + Intronic
903673825 1:25052179-25052201 GAGAGTAAGGAGAGCTGGTCTGG - Intergenic
903933688 1:26879784-26879806 CAGAGGATGGGGAGCTGGTCTGG + Intronic
903988231 1:27245093-27245115 CTGAGGAAGAAGCACTGGACTGG - Intronic
904008685 1:27377715-27377737 CAGAAGAGTGAGAACTGGGCTGG - Intergenic
904382205 1:30119202-30119224 CAGTGGATGGAGCACTGGCCTGG - Intergenic
904441324 1:30533949-30533971 CAGTGGATGGAGCACTGGCCTGG - Intergenic
904453849 1:30635149-30635171 CAGTGGAGAGAGCACTGGACTGG - Intergenic
904556092 1:31365539-31365561 CTGAGGAAGAAGCACTGGATGGG - Intergenic
905309629 1:37040409-37040431 CAGTGGAGAGAGTACTGGACTGG - Intergenic
905486083 1:38297898-38297920 GAAAGGAAGGAGAACTGGGCTGG - Intergenic
905769944 1:40630980-40631002 CAGTGGAAGGAGTCCTGGCCTGG + Intronic
905792059 1:40795019-40795041 CAGTTAAAGGAGCACTGGACCGG + Intronic
906184891 1:43854446-43854468 GAGAGGTAGGAGAACTGGGAGGG - Intronic
906553048 1:46682313-46682335 CAGAGGAAGGTGTGGTGGACAGG + Intronic
906559848 1:46748459-46748481 CAGAGGCTGGAACACTGGACTGG + Intergenic
906836367 1:49086727-49086749 CAGAGGCAGGACCACTGGGCTGG - Intronic
907249915 1:53131193-53131215 CAGAAGGTGGAGAGCTGGACGGG + Intronic
907837599 1:58125950-58125972 AGGAGGAAGGAGAAGGGGACAGG + Intronic
908030385 1:59992995-59993017 CAGAGGAAGCAAAGCTAGACAGG - Intronic
908638561 1:66196194-66196216 CATAGGAAGGAGTTCTGGAAGGG + Intronic
910106729 1:83639254-83639276 CTGAGGAAGAAGTACTGAACAGG - Intergenic
910674129 1:89800170-89800192 GAGAAGAAGGTGAACTGGAGAGG + Intronic
911870719 1:103094540-103094562 CAGAGGCAGAAGAAGTGGAAGGG - Intronic
912551106 1:110485906-110485928 CAGAGGAAATAGGACTGGGCAGG - Intergenic
913076436 1:115344223-115344245 CAGAGGAAGAGGAAATGGACAGG - Intergenic
914256656 1:145965451-145965473 GAAAGCAAGGAGAACTGGAATGG + Intronic
914331129 1:146671579-146671601 AGCAGGAAGGAGAACTGGATGGG + Intergenic
914801835 1:150967882-150967904 CAGAGGAAGCAGAAATGGCTAGG + Intronic
915100184 1:153493550-153493572 CAGAGCAAGCAGGACTTGACAGG - Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
915371480 1:155354953-155354975 TATAACAAGGAGAACTGGACTGG + Intronic
915640203 1:157218891-157218913 CAGTGGACAGAGAACTGGATTGG + Intergenic
915734791 1:158077910-158077932 CAGAGGGAGGAGTACTGGTGTGG + Intronic
916211777 1:162365582-162365604 CAGAGGAAGCAGGGCTGGGCAGG - Intronic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916735791 1:167605806-167605828 TAGAGGAAGGAGAGCTGTGCTGG - Intergenic
917304086 1:173608955-173608977 GAGAGGAAGGAGAAGGGGAAGGG + Intergenic
917621666 1:176802287-176802309 GAAAGGAAGGGGAACTGGACAGG + Intronic
918305251 1:183240134-183240156 AAGTGGAAGGAGAGCTGGAAAGG + Exonic
918662462 1:187106426-187106448 AAGAGGAAGGAAAAGTGGACTGG - Intergenic
919405307 1:197173804-197173826 AAGAGGAAGTAGTACTCGACTGG + Intronic
920013004 1:202883729-202883751 CAAAGGAGAGACAACTGGACAGG - Intronic
920247014 1:204595792-204595814 CACAGGAAAGAAAACTGGAGAGG - Intergenic
920378655 1:205523079-205523101 CAGTGGGTGGAGACCTGGACTGG + Intronic
920461831 1:206146407-206146429 CAGGGAAAAGAGAACTAGACAGG - Intergenic
920937861 1:210452472-210452494 CAGATGAAAGAAAACTGGCCAGG - Intronic
921079880 1:211730624-211730646 AAGAGAGAGGAGAGCTGGACAGG + Intergenic
921341315 1:214137308-214137330 TAGAGAAAGGAGAGCTTGACGGG + Intergenic
921810846 1:219511918-219511940 CAGAGGTAGGAGATGTGGAGAGG + Intergenic
922932829 1:229403593-229403615 CAGAGGAGGGACAAGTGGAAGGG + Intergenic
923946879 1:238898185-238898207 CTGAGGCAGGAGAATTGGCCAGG + Intergenic
924441130 1:244086392-244086414 AGGAGGAAGGAGGAGTGGACGGG - Intergenic
1062846437 10:710817-710839 TAACGGAAGCAGAACTGGACAGG - Intergenic
1063138135 10:3234846-3234868 AAGGGAAAGGAGAACAGGACCGG + Intergenic
1063228020 10:4034296-4034318 TAGAGGGACGAGAACAGGACGGG - Intergenic
1064151269 10:12867193-12867215 CAGAGGAAGGAGGAATGGAGGGG + Intergenic
1064304099 10:14149823-14149845 TACAGGAAGGAGAGCTGGCCGGG - Intronic
1064381284 10:14843698-14843720 GGGAGGAAGAAAAACTGGACAGG + Intronic
1065009370 10:21407703-21407725 CAGTGGAAGGGGAGCTGGAAAGG + Intergenic
1065547698 10:26838408-26838430 AAGAGGAAGGAGCAGAGGACAGG + Intronic
1066210221 10:33229722-33229744 CAGAGGAAGGAGCAATTGACTGG + Intronic
1066422494 10:35275807-35275829 CAGAGGAATGACCACTGGGCAGG + Intronic
1066625199 10:37398856-37398878 CAGAGGAGGGAGAAAGGGAGGGG - Intergenic
1067040822 10:42952249-42952271 CAGAGAAGGTAGAACTGGCCGGG - Intergenic
1067105308 10:43362452-43362474 CAGAGGAAGGAGGACTGCGCTGG - Intergenic
1068318845 10:55383128-55383150 CAGTGGAAGGGGAGCTGGAAAGG + Intronic
1068610913 10:59058977-59058999 CACAGGAAGGAGAAATTGCCTGG - Intergenic
1069729149 10:70599999-70600021 CAGAGGCAGGAGACCTGGCCGGG - Intronic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069788600 10:71005322-71005344 CTGAGGAAGGAGCACTGTTCTGG - Intergenic
1069872929 10:71544205-71544227 CAGATGCAGGAGAGGTGGACGGG + Intronic
1070543891 10:77437736-77437758 CAGAGGCAGGAGGCCTGCACCGG + Intronic
1070728244 10:78807114-78807136 CAGAGGAAAGAAAGCTGGCCAGG + Intergenic
1070795294 10:79212896-79212918 CACAAGACGGAGAACTTGACTGG - Intronic
1070874249 10:79787461-79787483 CAGCTGAAGGAGAATTAGACTGG + Intergenic
1071463792 10:85921781-85921803 CAGAGGAAGGGGACCCAGACTGG - Intronic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071565246 10:86668317-86668339 GGGAGGAAGGGGAACTGGCCTGG - Intergenic
1072035029 10:91555345-91555367 CAGAGTGAGGGGAACTGGAGGGG + Intergenic
1072229613 10:93403247-93403269 GAGGAGGAGGAGAACTGGACAGG - Intronic
1072318453 10:94225670-94225692 CAGATGAAAGAGCACTGGGCTGG + Intronic
1074406234 10:113182352-113182374 CAAAGGAAGAAGAAATGGAATGG - Intergenic
1075312247 10:121424195-121424217 CAGTGGAAAGAGAACTAAACTGG - Intergenic
1075576368 10:123580590-123580612 CACAGTAAGGAGCACAGGACGGG - Intergenic
1075633238 10:124013922-124013944 CAGGGGAAGGAGGACTAGCCAGG - Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1077219270 11:1408230-1408252 CACAGGGAGGGGAACTGGTCAGG - Intronic
1078329548 11:10408288-10408310 CAGTGCAAGGAGAAATGGAGCGG + Intronic
1078879254 11:15431937-15431959 CAGAGGTAGGAGTCCTGGGCTGG - Intergenic
1079107327 11:17579819-17579841 CAGTGGAAGGGGCGCTGGACTGG + Intronic
1079347987 11:19669730-19669752 AAGAGGAAAGGGAACTGGATAGG - Intronic
1079456835 11:20643636-20643658 CAGTGGAAAGAGCACTGGACTGG - Intronic
1079995088 11:27287278-27287300 CAGAAAGAGGAGAGCTGGACAGG - Intergenic
1080126448 11:28740061-28740083 GAGAGGAAGGAGAACAGGAAGGG + Intergenic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1081616233 11:44593033-44593055 TAGAGGAAAGAAAACTGGACTGG + Intronic
1081748304 11:45488415-45488437 CAGAGAATGAGGAACTGGACTGG - Intergenic
1083722986 11:64612578-64612600 CAGAGGAAGGAGAGTTGGGGAGG - Intronic
1083725354 11:64625189-64625211 AAGAGCAGGGAGAGCTGGACAGG - Intronic
1084327547 11:68410527-68410549 CAAAGCAAGGAGACCTGGTCAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084735205 11:71100936-71100958 CAGAGGAGGGAGGGATGGACGGG + Intronic
1084890958 11:72237039-72237061 CAGTGGAAGGAGAACTAGACGGG - Intronic
1085166079 11:74400537-74400559 CTGATGCAGCAGAACTGGACTGG - Intergenic
1085390167 11:76178191-76178213 CAGAGAAGGGAGGACTGGCCTGG + Intergenic
1085522572 11:77146982-77147004 CGGAGTAAGGAGAGCTGGGCAGG + Intronic
1085540889 11:77268731-77268753 CACAGTAAAGAGAAATGGACTGG + Intronic
1086452552 11:86931570-86931592 TAGAGGAAGGAGACATTGACTGG + Intronic
1087245109 11:95826096-95826118 CAGAGGCAGAAGAAGTGGAGGGG - Intronic
1087641895 11:100763963-100763985 AAGAGGAAGAAGAACTGGGAAGG - Intronic
1088238829 11:107753073-107753095 CATCAGATGGAGAACTGGACAGG + Intergenic
1088499817 11:110472361-110472383 GAGAGGAAGGAGGACTGGAGGGG + Intergenic
1088771270 11:113038047-113038069 CAGAGGCAGGAGCCCGGGACTGG - Intronic
1088813956 11:113409258-113409280 GAGAGGAGGGAGAACTGTCCAGG + Intergenic
1089413003 11:118262855-118262877 AAGGGAAAGGAGAAATGGACTGG + Intronic
1089701817 11:120249257-120249279 AAGAGGAAAGAGTACTGAACAGG - Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1091406646 12:213563-213585 AGGTGGAAGGAGAAGTGGACAGG - Intronic
1091596718 12:1883417-1883439 CAGAGGAAGGAGGAGCGGAGAGG - Intronic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093894546 12:24562133-24562155 CAGAGGGAGGGGGACTGGGCTGG - Intergenic
1094071755 12:26423761-26423783 CAGAGGGAAGAAAACTAGACTGG + Intronic
1094313705 12:29114582-29114604 CACAGGAAGAAGAACAGGTCTGG + Intergenic
1094381068 12:29843475-29843497 CAGCGGAACTAGAACTGGAAAGG + Intergenic
1095502296 12:42853682-42853704 CAGAGAAAGGAGAACTTCTCAGG - Intergenic
1096192715 12:49630859-49630881 TAGAGGTAGGAGAAGTGGAAGGG + Intronic
1096655834 12:53091583-53091605 CAGAGGAAGGAGAGCTGGAAAGG - Intergenic
1097442653 12:59630057-59630079 CAAAGGAGTGAGAACTGGATTGG + Intronic
1097740671 12:63238600-63238622 CAAAGGAGGGAGAAAGGGACTGG - Intergenic
1098704323 12:73667825-73667847 CAGAGGACTGAGCACTGGAGAGG - Intergenic
1098722002 12:73912085-73912107 CAGAGGAAACTGAACTGTACTGG + Intergenic
1099508851 12:83509122-83509144 CAAAGCAAGGAGAGCTGGAAAGG + Intergenic
1100559456 12:95733687-95733709 CAGATGAAGGAAAACTGAACTGG + Intronic
1101345797 12:103885151-103885173 CACAGGAAGGAGACCTGGATTGG - Intergenic
1101980859 12:109405879-109405901 CAGAGACAGGAGATCAGGACAGG - Intronic
1102358301 12:112259765-112259787 CAGAGGCAAGAGAACTTTACAGG - Intronic
1102857606 12:116307644-116307666 CAGAGAAAGGAGCACTGGAGTGG - Intergenic
1103167434 12:118782559-118782581 AAGGGGAAGGTGCACTGGACTGG - Intergenic
1103366961 12:120390549-120390571 CAGAGGAAGGAGAGAAGGAAAGG + Intergenic
1103868643 12:124074746-124074768 CAGAGGAAGGGGTCCTGAACGGG + Intronic
1104265865 12:127231972-127231994 CTCAGGAAGGAGAGCTGGAAAGG - Intergenic
1105577533 13:21668054-21668076 AAGAGGAATGAGCACTGGAATGG - Intergenic
1106369259 13:29115704-29115726 CTAAGGAAGGAGAGGTGGACTGG + Intronic
1106823064 13:33488088-33488110 CAGAGGAAGAGGAACTAGAGGGG - Intergenic
1107163490 13:37259015-37259037 CTAAGGAAGGAGAACAGGATAGG + Intergenic
1107698294 13:43022184-43022206 CAGTATAAAGAGAACTGGACTGG - Intergenic
1108467911 13:50736769-50736791 GAGAGAAAGGAGAAATGGAGAGG + Intronic
1110622196 13:77609409-77609431 GAGGGGAAAGAGAACTAGACCGG + Intronic
1110795430 13:79631559-79631581 CACAGGGAGGAGGACTTGACTGG + Intergenic
1111942495 13:94625515-94625537 CAGAGGAGGGGGAGCTGGGCAGG - Intronic
1114345451 14:21789822-21789844 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1114444556 14:22778283-22778305 GAGTGAAAAGAGAACTGGACAGG - Intronic
1114635129 14:24182962-24182984 CAGAGGAAGGTGAGCAGGGCAGG - Exonic
1117080193 14:52143743-52143765 GAAAGGAAGGAGAACTGAGCAGG + Intergenic
1117231019 14:53718803-53718825 AAGAAGAAGGAGAACAGGAATGG - Intergenic
1117374802 14:55110552-55110574 CTGATGGAGGTGAACTGGACAGG - Intergenic
1118102754 14:62624923-62624945 AAGAGGAGGGAGAGCAGGACTGG - Intergenic
1118389571 14:65284758-65284780 AAAAGGAAGGAAAAATGGACAGG - Intergenic
1118493320 14:66283177-66283199 CAGAGGCAGGAGAATTGGCCAGG - Intergenic
1119147466 14:72330176-72330198 CAAATGGGGGAGAACTGGACCGG - Intronic
1119188043 14:72658596-72658618 CAGAGGAAAAAGAAATGGATAGG + Intronic
1119199344 14:72741434-72741456 CAGAGCAAGGATATTTGGACAGG + Intronic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1120614692 14:86688820-86688842 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1121139248 14:91526405-91526427 CAGAGAAAGGAAAACTAAACAGG - Intergenic
1121427354 14:93861957-93861979 AGGAGGAAGGAGAGCTGGATGGG - Intergenic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1121718968 14:96096108-96096130 CAGAGGATGGAAAGCTGGAATGG - Intergenic
1122602384 14:102928246-102928268 CAGAGGAAGCGGATCTGGCCTGG - Intronic
1122774217 14:104110132-104110154 CGGAGGCAGGAGACCTGGGCCGG + Intronic
1124034433 15:26041462-26041484 CTGAGCAAGAAGAACTGAACTGG - Intergenic
1124163351 15:27294974-27294996 AAGAGGAAGGAGACCTGGCCAGG + Intronic
1124342512 15:28899299-28899321 CAGAGGAATGAGAAGTTCACAGG - Intronic
1124529780 15:30495548-30495570 AAGAGGAAGGTGAATTGGTCGGG + Intergenic
1124768879 15:32512140-32512162 AAGAGGAAGGTGAATTGGTCGGG - Intergenic
1124858242 15:33411767-33411789 CAGAGGGAGGAGACCAGCACAGG - Intronic
1124920957 15:34025798-34025820 CGGAGGAAGGAGAAAAAGACAGG + Intronic
1125793257 15:42385991-42386013 CCAGGGAAGGAGAATTGGACAGG - Intronic
1126416514 15:48423405-48423427 CAGTGGAAAGAGCACAGGACAGG - Intronic
1126689028 15:51273546-51273568 CAGAGGAAAGAGCACTGGAATGG + Intronic
1126795208 15:52254679-52254701 AAGAGGAAGAAGAACAGGAGAGG + Intronic
1127402071 15:58598768-58598790 CATTGGAAGGAGAAAAGGACAGG - Intronic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1128440305 15:67701146-67701168 GAGAGGAAGGAAAAAAGGACAGG + Intronic
1128557791 15:68643409-68643431 GAGAGGCAGGAGCACTGGATGGG - Intronic
1128761390 15:70218350-70218372 CAGAGCCAGGAGTACTGGACAGG - Intergenic
1128775736 15:70318706-70318728 AAGAGGGAGGAGAATAGGACTGG + Intergenic
1129699270 15:77758281-77758303 CAGAAGAAAGAGCACTGGACTGG + Intronic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129789384 15:78330838-78330860 GAGTGGAAGGAGCACTGGACTGG - Intergenic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130150391 15:81307223-81307245 TAGAGAGAGGAGTACTGGACAGG + Intronic
1130610924 15:85360290-85360312 CAGAGGCTGGAGAGTTGGACAGG + Intergenic
1130913904 15:88290257-88290279 AAGAGGAGGAAGAACTGGAGTGG + Intergenic
1132024481 15:98393115-98393137 GGAAGGAAGGAGAACTGGAAAGG + Intergenic
1132068905 15:98758280-98758302 CCAAGAAAGGAGAACTAGACGGG - Intronic
1132659915 16:1056737-1056759 CAGAGGGAGGGGAGCTGGAGAGG + Intergenic
1132929894 16:2453725-2453747 CTGAGGAAGGAGACCTGGGCTGG - Intronic
1133413747 16:5589828-5589850 GAGTGGAAGGAGAGCTGCACTGG - Intergenic
1134026516 16:10958187-10958209 CAAAGGAAGGAGAACATGTCTGG + Intronic
1134052795 16:11148697-11148719 CAGGGGATGGAGCACTGGCCTGG - Intronic
1134602327 16:15543112-15543134 CAGTGGAAGGGGAGCTGGAAAGG + Intronic
1135233141 16:20728687-20728709 CTCAGAAAGGAAAACTGGACAGG + Intronic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1135592838 16:23717030-23717052 GAGAGGAAGGAGAACAAGAAGGG + Intergenic
1137428176 16:48397525-48397547 CAAAGCAGGAAGAACTGGACTGG + Intronic
1137839210 16:51624519-51624541 CAGAGCGAGGACATCTGGACGGG + Intergenic
1137923906 16:52521384-52521406 CAGAGAAGGTAGAACTGGCCAGG - Intronic
1138582166 16:57948747-57948769 GAGTGGAAGGATGACTGGACAGG - Intronic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1138875936 16:60949910-60949932 CAAAGGAAGCCAAACTGGACTGG - Intergenic
1139022514 16:62768069-62768091 CATATGAAGGAGACCTGGGCAGG - Intergenic
1139077195 16:63465591-63465613 GAGAGTAAGGTGAACTGGAGGGG - Intergenic
1140002425 16:71039325-71039347 AGCAGGAAGGAGAACTGGATGGG - Intronic
1140481126 16:75263466-75263488 CAGAGGAAGGGGCACTGAGCAGG + Intronic
1140899973 16:79358349-79358371 CCAAGGGATGAGAACTGGACAGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141158621 16:81613995-81614017 CAGAAGAAGGACAACTAGACAGG + Intronic
1141427660 16:83954140-83954162 CAGAGGAAGAAAAGCTGGTCAGG - Intronic
1141926678 16:87174416-87174438 CAGAGGAAGCAGGACTGCAAAGG - Intronic
1142750181 17:1982808-1982830 CAGAGGAAGGAGGAATGGGGTGG + Intronic
1143627236 17:8117638-8117660 GAGAGGAAGGAGCGTTGGACAGG - Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1145060734 17:19731658-19731680 CAGGGAAGGGAGAACTGGAGAGG - Intergenic
1145202710 17:20961021-20961043 CTCAGGAAGGAAAACTGAACTGG - Intergenic
1146456899 17:33015652-33015674 CAGCAGGGGGAGAACTGGACAGG - Intronic
1146680958 17:34807884-34807906 TAGAGGAAAGAGCACTGGATTGG + Intergenic
1147052946 17:37810607-37810629 CAAAGGAAAGAGAACCAGACGGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1148103312 17:45105742-45105764 CAAAGGGAGCAGAACTGAACCGG + Exonic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148440907 17:47711202-47711224 CAGGGAAAGGAGGACAGGACTGG - Exonic
1148696952 17:49566319-49566341 CAGAGGAAGGGAAAGTGGAAAGG + Intergenic
1149325723 17:55527984-55528006 CAGAGGAGGAAGAACGGGAAAGG - Intergenic
1150156545 17:62858457-62858479 CAGAGGAAGGTTAACAGGGCTGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151138081 17:71966743-71966765 CAGGGGAAGGCAACCTGGACAGG + Intergenic
1151455623 17:74224024-74224046 CAGAGGACAGAGTTCTGGACAGG + Intronic
1151477888 17:74354161-74354183 GAGAGGAAGGAGATCCTGACTGG + Exonic
1152423798 17:80208194-80208216 AGGAGGAGGGAGACCTGGACCGG + Exonic
1153762208 18:8342093-8342115 GAAAGGAAGGAGGCCTGGACAGG + Intronic
1153793566 18:8602114-8602136 CAGAGGAAGGGAAACTGGCTGGG + Intergenic
1154312034 18:13274253-13274275 CAGAGGGAGGAGGCCTGGATGGG + Intronic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156456176 18:37295825-37295847 GAGAGGAAGAGGAACTGCACTGG + Intronic
1156481939 18:37441800-37441822 CTGAGGGAGGAGGACTGCACTGG - Intronic
1157138402 18:45081669-45081691 TGGAGGAAGGAGAGCTGGATTGG - Intergenic
1157337784 18:46754331-46754353 CAGAGGAAGTTGAACTTGAGTGG - Intronic
1157393332 18:47321551-47321573 CAGAAGCAGGAGAATTGCACTGG + Intergenic
1157568646 18:48697660-48697682 CAGCAGAAGGAGCACTGGGCTGG - Intronic
1157958593 18:52126672-52126694 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158570992 18:58596917-58596939 CTGAGGTAGGAGAACTGGTTGGG - Intronic
1158637401 18:59173050-59173072 GAGAGGACAGAGAACTAGACAGG - Intergenic
1159101978 18:63968146-63968168 CAGAGGCAGGAGAAATGGAGAGG - Intronic
1159401039 18:67934347-67934369 GAGAGGAAGGAAAACAGGAAAGG + Intergenic
1160238441 18:77104381-77104403 CAAAGGAAGGAGAACTGGTGAGG + Intronic
1160473038 18:79156248-79156270 AAGAGGAAAGAGAAATGGGCTGG - Intronic
1160613643 18:80108328-80108350 CAGGGGAAGGAACACTGGAGGGG + Intergenic
1161164388 19:2778333-2778355 CTGAGGTGTGAGAACTGGACAGG + Intronic
1161332993 19:3697120-3697142 CAGACGAAGGAGGACTGAGCCGG + Intronic
1161479226 19:4502375-4502397 CAGTGGCAGGAGAGCTGGGCGGG + Exonic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1163465950 19:17468830-17468852 CAGAGGAGGGGGAGCTGGAAGGG + Intronic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1164806648 19:31122217-31122239 CAGAGTAAAGAGAGCTGGCCAGG - Intergenic
1165380416 19:35475640-35475662 CAGAGGTAGGCTAACTGGATTGG - Intergenic
1166206699 19:41274548-41274570 CAGTGGAAAGAAAACTGAACTGG - Intronic
1166737577 19:45095229-45095251 CTGAGGCAGGAGAATTGGCCTGG - Intronic
1167158339 19:47752617-47752639 CTGAGGAGGGAGGCCTGGACGGG - Intronic
1168129680 19:54310280-54310302 TAGAGGAAGGAGAACAGACCTGG - Intronic
1168169724 19:54577306-54577328 TAGAGGAAGGAGAACAGGCTGGG + Intronic
926253301 2:11168648-11168670 CAGAGGAGGGAGGACTGCAGGGG - Intronic
926319721 2:11740875-11740897 CAGAGGAAGCAGGTCTGAACAGG + Intronic
926977593 2:18530865-18530887 CAGAGGAAGGAGAACTCACTGGG - Intergenic
928208110 2:29301812-29301834 CAAAAGAGAGAGAACTGGACTGG + Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
928885649 2:36145131-36145153 CAAAGGAAGGAAACCTGGAAAGG - Intergenic
929918415 2:46155073-46155095 CTGTGGAAGGTGAACAGGACTGG + Intronic
930320103 2:49843722-49843744 CAGTGGAAGGGGAGCTGGAAAGG + Intergenic
932300408 2:70663153-70663175 TAGTAGAAGGAGCACTGGACTGG + Exonic
932303200 2:70683114-70683136 CTGAGGCAGGAGAATTGAACTGG - Intronic
932435310 2:71699759-71699781 CAAAGGAAGGGGACTTGGACAGG + Intergenic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934113535 2:88764446-88764468 CAGAGGCAGGAAAGCTGAACTGG + Intergenic
934166182 2:89296382-89296404 CAGGGCAAGGAGAACTGGGTGGG - Intergenic
934201093 2:89886074-89886096 CAGGGCAAGGAGAACTGGGTGGG + Intergenic
935201633 2:100861606-100861628 CACAGGAAGGAGGCCTGGGCTGG + Intronic
935263132 2:101371818-101371840 CAGAGGGAGGAGCCTTGGACTGG + Intronic
936121283 2:109747647-109747669 CTGAGGCAGGAGAACTGGGGTGG + Intergenic
936223414 2:110623824-110623846 CTGAGGCAGGAGAACTGGGGTGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
937022691 2:118672843-118672865 GAAAGGAAGGAGGACTGGGCAGG - Intergenic
937289368 2:120772906-120772928 CAGAGGAAGGAGACCTTGCGGGG - Intronic
937320926 2:120960292-120960314 CAGAGGAGGGAGCACTGTAGGGG + Intronic
937836064 2:126471374-126471396 CAGAGGAATGAGGAGTGGAAAGG + Intergenic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
940375074 2:152948538-152948560 CAGAGGGAAGAAAACTGGAATGG - Intergenic
942381172 2:175392669-175392691 CAGAGGAAAGTGAACAGGAATGG - Intergenic
943073805 2:183171878-183171900 CAGAGGCAGGACCTCTGGACTGG + Intergenic
943089582 2:183357979-183358001 CACAGGAATGAGAACTGCAACGG + Intergenic
943636030 2:190307932-190307954 CAGAGTTATGAGAAGTGGACAGG - Intronic
944981316 2:205123840-205123862 GAGATGCAGGAGAACAGGACAGG + Intronic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
945395222 2:209307769-209307791 CAGAGGAAGGAGGACTTCCCAGG + Intergenic
945473970 2:210260237-210260259 ATGTGGAAGGAGCACTGGACAGG - Intergenic
946018782 2:216625257-216625279 CAGAGGAAGGAGAAATTCAAAGG - Intergenic
946410106 2:219511483-219511505 CGGAGGCAGGTGAATTGGACTGG + Intergenic
946854724 2:223941410-223941432 CAGAGGAAGGAGGAAAGGACAGG - Intronic
946905537 2:224412721-224412743 CAGTGGGAAGAGAACTGGTCTGG + Intergenic
947024779 2:225724893-225724915 GAGAGGAAGGAGGCCTGGAAGGG - Intergenic
948705126 2:239786216-239786238 GAGAGGAGGAAGGACTGGACAGG + Intronic
1169076645 20:2764070-2764092 CAGAGGAGGGAGCTGTGGACAGG - Intergenic
1169770727 20:9197178-9197200 CAGAAGAAAGACAACTGGAGAGG - Intronic
1170308223 20:14963358-14963380 CAGGGGAAGGAGACCTGGGAGGG + Intronic
1170746910 20:19107626-19107648 CAGAGGAAGAAGAAATGCAGAGG - Intergenic
1171322354 20:24257628-24257650 CAGAGGAGGGAGAATAGGTCAGG + Intergenic
1171896082 20:30812097-30812119 CGCAGAAAGGAGAACTGGCCTGG - Intergenic
1171959988 20:31486353-31486375 CTGAGGATGGAGGATTGGACTGG - Intergenic
1172442334 20:34974737-34974759 CAGAGGCTGGAGAGCTGGGCTGG - Intergenic
1172588132 20:36099306-36099328 CAGAGAAGGGAGAGCTGGAAAGG - Intronic
1172638300 20:36424638-36424660 CAGAGGAATGAGAACGGCTCTGG - Intronic
1172640536 20:36437729-36437751 CAGAGGGAAGAGAACAGGTCAGG + Intronic
1172661276 20:36570793-36570815 GAGAGGAAGGAGAGGTGGAAAGG - Intergenic
1173456623 20:43207820-43207842 CAGAGGATGGACCACTGGACTGG + Intergenic
1173868316 20:46327027-46327049 CAGTGGAAGGAGCCCTGCACTGG - Intergenic
1174714722 20:52745658-52745680 TAGAGGAAGGAGGATTGGAGAGG + Intergenic
1174757461 20:53174050-53174072 GAGAGGAAGGGGAAATGGAGAGG + Intronic
1175538294 20:59730544-59730566 CAGAGGCTGCAGAACTGTACAGG + Intronic
1175689110 20:61052952-61052974 CAGAGGAAGGGGAATTGGCCCGG + Intergenic
1175777699 20:61663527-61663549 CGGAGGAAGGTGAACAGGGCAGG + Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1177369426 21:20182138-20182160 GAAAGGAAGGATAACTGAACTGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177801584 21:25833699-25833721 CAGGGGAAGGGGACCTGGAAAGG - Intergenic
1178262614 21:31113994-31114016 CAGAGAAAGGAGGACAGGAGTGG + Intergenic
1178529362 21:33362281-33362303 CAGAGGAAGGAGTCCCGAACAGG + Intergenic
1178986145 21:37304798-37304820 CATAGCAAGGAGAACTGAATAGG - Intergenic
1179276879 21:39899798-39899820 CAGAGGAAGGAGCAAAGGATGGG + Intronic
1179353852 21:40640291-40640313 CAGCGGAGGGAGAACAGGGCAGG + Intronic
1180056261 21:45360635-45360657 CTGAGGCAGGAGAACTGCCCGGG - Intergenic
1181574069 22:23782948-23782970 CAGGGGAGGGAGCACTGGACTGG - Intronic
1182107811 22:27701816-27701838 CAGAGGAATGAGCACTGAGCAGG - Intergenic
1182150993 22:28027005-28027027 AAGACGAAGAAGAACAGGACAGG - Intronic
1182158437 22:28098072-28098094 CAGATGACGGAGAGCTGGAAGGG + Intronic
1182446631 22:30393452-30393474 CACAGGAAGGAGCACTGGACCGG - Intronic
1182643323 22:31786875-31786897 GTGAGGCAGGAGAACTGAACAGG - Intronic
1183160593 22:36110514-36110536 CAGAGAAAAGAGATTTGGACAGG + Intergenic
1183314650 22:37130192-37130214 GAGAGGAAGAAGCACTGGTCGGG + Intronic
1183337769 22:37260468-37260490 CAGAGGCGGGAGAAGTGGAGCGG + Intergenic
1183338525 22:37265024-37265046 TAGAGGAAGGAGAGCTGGAGAGG + Intergenic
1183468277 22:37991212-37991234 CTGAGGGAGGAGAATTGCACAGG - Intronic
1183505817 22:38208357-38208379 CAGGGAAAGGAGCACTGGATTGG - Intronic
1183509330 22:38225786-38225808 CAGAGGCAGTAGAGCTGGTCTGG - Intronic
1183589465 22:38771364-38771386 CAGAGGAAGGACATTTGAACTGG - Intronic
1183747661 22:39700861-39700883 CAGAGGAAGAAGAAATGGTTTGG + Intergenic
1184008116 22:41725659-41725681 CAGAGGAAGAGCAACTGCACAGG - Intronic
1184089545 22:42285023-42285045 CAGAGGCTGGAACACTGGACAGG - Intronic
1184379581 22:44136668-44136690 CAGAGGGAGGAGAGCTGGGGTGG - Intronic
1184686714 22:46099554-46099576 CAGAGGAAGGAGAACAGCGTGGG + Intronic
949627804 3:5887623-5887645 AAGAGTAAGGAGAAATGGCCTGG - Intergenic
951113856 3:18836940-18836962 CAGGGGATGGAACACTGGACGGG + Intergenic
952881837 3:37990527-37990549 CAGGGGATGGAGGCCTGGACTGG - Intronic
953130452 3:40132886-40132908 CTGAGTAAGGAGGGCTGGACTGG - Intronic
953166225 3:40467356-40467378 CAGAGGCCTGAGAACTGGAAGGG + Intergenic
954361153 3:50123562-50123584 CTGAGGAAGGAAACCTGGTCTGG + Intergenic
954361409 3:50124654-50124676 CAGGGGAAGGAGATCTTGACAGG + Intergenic
955240216 3:57171111-57171133 CAGAGAGAGGAGAACTGTTCTGG + Intergenic
955645640 3:61134530-61134552 CAAAGGAAGGAGAAATGATCTGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956438009 3:69253283-69253305 GAGTGGAAAGAGCACTGGACAGG - Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
957085101 3:75670545-75670567 CGCAGAAAGGAGAACTGGCCTGG - Intergenic
960391380 3:117081459-117081481 TGGAGGAAGGAGAAATGGTCTGG - Intronic
960551785 3:118984064-118984086 AAGAGGAAGGAGAGCTGGGTAGG - Intronic
961108962 3:124267634-124267656 CATAGGCAGGAGGACTGGTCTGG - Intronic
961308865 3:125979920-125979942 CAGAGGAAGGAGTGCTGAAGGGG - Intronic
961345293 3:126260128-126260150 AAGAGGAAGGAGATGTGGAGAGG - Intergenic
961714080 3:128846888-128846910 TGGAGGCAGGAGCACTGGACTGG + Intergenic
962012337 3:131404042-131404064 CAGATGTGGGAGAACTAGACAGG + Intergenic
962022858 3:131518307-131518329 CAGATGAGGGAGAACTGGAGAGG - Intergenic
962023004 3:131519370-131519392 CAGATGAAGGAGAATTGGAGAGG - Intergenic
962174296 3:133136734-133136756 CAGAGGAAAGGGAGCTGGTCAGG + Intronic
962973892 3:140429505-140429527 CAGAGGGAAGAAGACTGGACTGG + Intronic
963145361 3:141988502-141988524 CTGAGGCAGGAGAACTAGAGGGG - Intronic
965806293 3:172545943-172545965 CTGAGGCAGGAGAACTGCCCAGG - Intergenic
966214894 3:177491890-177491912 CAGAGGAAGGACAGCTGCAGGGG + Intergenic
966496189 3:180584011-180584033 GAGAGGAAAGGGAACTTGACAGG + Intergenic
966747994 3:183296537-183296559 CAGAGGAACTTGACCTGGACTGG - Intronic
966818955 3:183910094-183910116 CAGTGGAAAGAGCACTGTACTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
969042988 4:4315507-4315529 GAAAGGAACGTGAACTGGACTGG - Intronic
969363929 4:6683017-6683039 CAGAGGGTGGAGGACTGGAGGGG - Intergenic
969406878 4:6999395-6999417 GAGAAGAAGGTGAACTGGAAGGG - Intronic
969512943 4:7629993-7630015 CAGAGGTAGGAGAACTGGAGGGG - Intronic
969604980 4:8197871-8197893 TAGAGAAAGGTGAACAGGACGGG + Intronic
969947685 4:10801287-10801309 CAGAGAAAAGAGAGCTGCACTGG - Intergenic
970829435 4:20319762-20319784 CAGAGGAGGCAGTGCTGGACTGG + Intronic
972123521 4:35735575-35735597 GAAAGGAAGGAGAAATGGGCTGG + Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976802341 4:89006779-89006801 CAGCGGAAGGAGAGCTAGACAGG + Intronic
977114630 4:93007940-93007962 CTGAGGCAGGAGAACTGCCCAGG + Intronic
977603511 4:98959060-98959082 CTGAGGAAGGAGAACTCGGGAGG - Intergenic
977706396 4:100075669-100075691 CAGAGGAGGGAGAAACGGAAAGG - Intergenic
979381443 4:120011437-120011459 CAGAGGAAGGAGGACAGTATAGG - Intergenic
979646999 4:123081254-123081276 CAGAGGAGGCAGAAATGAACAGG - Intronic
982651638 4:158094775-158094797 CAGAGGCATTGGAACTGGACTGG + Intergenic
983229350 4:165113418-165113440 CTGAGGTGGGAGAACTGGCCAGG - Intronic
984290683 4:177789966-177789988 AAGAGGAGCGAGGACTGGACTGG + Intronic
984527974 4:180880160-180880182 CAGAGGAATGAGAACTGAATGGG + Intergenic
984828531 4:183950408-183950430 CAGAAGAAGGGGACCTGGCCTGG + Intronic
984913421 4:184698178-184698200 AAGAGGAAGGAGCACTGGGAAGG - Intronic
985445846 4:190021021-190021043 CACGGAAAGGAGAACTGGCCTGG + Intergenic
985670715 5:1205224-1205246 CAGAGGAAGGAGAGAAGGAAAGG - Intronic
985916726 5:2925797-2925819 CAGAGGAAGAAGAAGAGGAAAGG - Intergenic
985968175 5:3353504-3353526 CAGAGAAAGGGAAACTGGAGTGG + Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986457909 5:7938871-7938893 GAGAAGGGGGAGAACTGGACAGG + Intergenic
986588702 5:9346287-9346309 CAGTGGAAGGGGAGCTGGAAAGG - Intronic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
988466761 5:31499065-31499087 CAGAGGATGGAGATCTGCAGTGG - Intronic
988942160 5:36157534-36157556 AAGAGGAAGGAGAACTCATCTGG + Intronic
989632376 5:43498728-43498750 CAGAGGAAGATGAACTGGGTGGG - Intronic
990119724 5:52436134-52436156 TAGTAGAAGGAGAACTGGACTGG + Intergenic
990181461 5:53164957-53164979 CAGAGGAAAGAGTCCTGCACTGG + Intergenic
990361713 5:55027511-55027533 TTGAGGAAAGAGCACTGGACTGG + Intronic
990384497 5:55246393-55246415 CAGAGGAAGGAGAAGCCAACAGG + Intergenic
991329957 5:65483203-65483225 ACCAGAAAGGAGAACTGGACCGG + Intergenic
991449143 5:66733199-66733221 CAGAGGCAGGACAACTGAAGGGG - Intronic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
992171887 5:74110167-74110189 AAGAGGGAGGAGAGTTGGACTGG - Intergenic
992218690 5:74550185-74550207 CAGAGGAAAGAAAACAGGAAGGG + Intergenic
992361222 5:76040584-76040606 CAGAGGAAGCAAAAATGGAGAGG + Intergenic
993763996 5:91832865-91832887 GAAAGGAAGGAGAATTGGATAGG + Intergenic
993942775 5:94080801-94080823 GAAAGGAAGGAGAACAGGATTGG - Intronic
994433224 5:99695359-99695381 CAGTGGAAGGGGAGCTGGAAAGG + Intergenic
995637402 5:114209302-114209324 CAGAGGAAGGGGAACTAGTAAGG - Intergenic
997263136 5:132478810-132478832 CAGAGGAAGGAGGCCTGGGGTGG - Intergenic
998004189 5:138646503-138646525 CAGGGGCAGGAGCACTGGAGTGG - Intronic
998296385 5:140973408-140973430 CAGAGGATGAAAAACTGGAGTGG - Intronic
999264220 5:150256028-150256050 AAAAGAAAGGAGAACTGCACGGG + Intronic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999367375 5:151031883-151031905 CAGAGGAAGCCGACCTAGACCGG - Intronic
999394300 5:151217241-151217263 TAGAGGAAAGAGCACTGGACTGG - Intronic
999673126 5:153974858-153974880 CAGTGGAAGGAGCACTGTGCTGG + Intergenic
999674305 5:153983512-153983534 CACAGGAAGGAAACCAGGACAGG - Intergenic
999687447 5:154115716-154115738 CAGTGGAAGGAGCACTGAACAGG + Intronic
1000669804 5:164046829-164046851 CAAAGTCAGGAGAAATGGACAGG - Intergenic
1001200001 5:169707426-169707448 CAGAGGAAGGACACAAGGACAGG - Intronic
1001804270 5:174570069-174570091 CTGAGGGAGGAGGACTGAACCGG + Intergenic
1001956308 5:175850371-175850393 CAGAGGCAGGAAAGCTGCACAGG + Intronic
1002516082 5:179760032-179760054 CAGAGGAAAGGAAACAGGACTGG + Intronic
1002758446 6:183321-183343 CAGAGGCAGGAGAACGGGCAAGG - Intergenic
1002961804 6:1922610-1922632 CAGAGGATGGGGTACAGGACGGG - Intronic
1003501580 6:6707555-6707577 CAGATGAAAGAGAACTTGGCTGG - Intergenic
1004747608 6:18526890-18526912 CAGATGAAGGATAAATGGACAGG + Intergenic
1004907537 6:20250591-20250613 CAGTGGAAGGAAAGCTGGAAAGG + Intergenic
1006174306 6:32112711-32112733 AAGAGGATGGAGAACTGGTGTGG + Intronic
1007256879 6:40535712-40535734 GGGAGGAAGGAGAACAGGAAGGG + Intronic
1007356082 6:41318847-41318869 CAGTGGAAGGAGTGCTGGGCTGG - Intergenic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1010620167 6:78063910-78063932 CAACGGAATGAGAATTGGACTGG + Intergenic
1011310128 6:85972496-85972518 CAGTGGAAGGGGACCTGGAAGGG + Intergenic
1011357805 6:86490427-86490449 GGGAGGAAAGAGAACTGGTCAGG - Intergenic
1011643661 6:89437314-89437336 CTGAGGAAAAAGAACTGGTCGGG - Intronic
1011700542 6:89950822-89950844 AACAGGAGGGAGAGCTGGACCGG - Exonic
1011803584 6:91046229-91046251 GAGAGGAAGGAGCAGTGGAGAGG - Intergenic
1011938540 6:92813302-92813324 CAGAGTAAGGATGACTGGTCAGG - Intergenic
1012211822 6:96528825-96528847 GAGAGGAAGGAGATGCGGACTGG - Intronic
1012769036 6:103405274-103405296 CAGCAGAAGGAGAGCTGGAAAGG + Intergenic
1013074259 6:106756461-106756483 CAAAGGAAAGAAAACTGGTCTGG + Intergenic
1013638436 6:112050340-112050362 CAGTGGAAGGAGTCCTGGACTGG + Intergenic
1013648518 6:112169597-112169619 AAGAGGAAGGAGAACTGAGGTGG + Intronic
1013796548 6:113895357-113895379 AAGAGGAAGGATGAGTGGACAGG + Intergenic
1013888308 6:114998165-114998187 CAGTGGAAGGGGAACTGGAAGGG - Intergenic
1014206099 6:118657004-118657026 CACAGGAAGCAGGACTGGAAAGG - Intronic
1014818424 6:125959313-125959335 CAGAGGAAGAGGACCTGGAAAGG + Intronic
1015797067 6:137023669-137023691 CCGATGAAGCAGAACTGCACAGG + Intronic
1016701316 6:147057330-147057352 GAAAGGAAAGAGAAATGGACAGG - Intergenic
1017788374 6:157774590-157774612 CAGAGGAAGGAGACCCCGGCAGG - Intronic
1018048244 6:159983961-159983983 AAGAGAAAGCAGAACTGGACTGG + Intronic
1019186362 6:170222954-170222976 CAGAGGACGCAGACCTGGGCAGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019950333 7:4367088-4367110 CTAAGGAAGGAGAACTGCTCGGG + Intergenic
1020285061 7:6672328-6672350 CTGAGGCAGGAGAATTGGGCAGG + Intergenic
1021316673 7:19156598-19156620 CAGAGGAAGCAGAAATGCAAAGG - Intergenic
1021601299 7:22366607-22366629 GAAAGGAAGGAGATCTGAACAGG + Intergenic
1021778316 7:24075442-24075464 CTGGGAGAGGAGAACTGGACAGG - Intergenic
1022215739 7:28259266-28259288 CAAAGGAAGGAGTCCTGAACAGG + Intergenic
1022518505 7:30990376-30990398 CTGAGGTTGGAGAGCTGGACTGG - Intronic
1023156917 7:37260564-37260586 CAGTGGAGGGAGAACTGGGCAGG - Intronic
1023595756 7:41828201-41828223 CAGAGGAAGGTGAACTGCAGTGG + Intergenic
1023996429 7:45161700-45161722 AGGAGGAAGAAGAACTGGGCTGG + Intronic
1024035712 7:45506073-45506095 GGCAGGAAGGGGAACTGGACAGG - Intergenic
1024035722 7:45506113-45506135 GAGAGGAAGAGGAATTGGACAGG - Intergenic
1024035735 7:45506181-45506203 GACAGGAAGGGGAGCTGGACAGG - Intergenic
1024035740 7:45506198-45506220 GACAGGAAGAGGAACTGGACAGG - Intergenic
1024035751 7:45506249-45506271 GAGAGGAAGGGACACTGGACAGG - Intergenic
1024035762 7:45506300-45506322 GACAGGAAGGGGAACTAGACAGG - Intergenic
1024035766 7:45506317-45506339 GAGAGGAAGAGGAAATGGACAGG - Intergenic
1024035781 7:45506419-45506441 GAGAGGTAGGGGAACTGGACAGG - Intergenic
1024693130 7:51824785-51824807 TAGAGGAAGTAAGACTGGACAGG - Intergenic
1027332352 7:77111463-77111485 CACAGGAAAGATAACTGGACGGG - Intergenic
1028999643 7:97139515-97139537 CAGAGGAAAGAGCACCAGACAGG + Intronic
1029130319 7:98325282-98325304 CTGAGGCAGGAGAACTGCAGAGG + Intronic
1029306653 7:99624684-99624706 CAGAGGAAGCAGAGCTGCGCTGG + Intronic
1029372999 7:100160977-100160999 CAGAAGAGAGAGAACTGGGCTGG + Intronic
1029564124 7:101323736-101323758 CATAGAAAGGAGAACCGGGCTGG - Intergenic
1030105908 7:105987139-105987161 CAGAGGAAGGAAAGCTGCCCAGG + Intronic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1030880462 7:114871871-114871893 GAGTGGAAAGAGCACTGGACTGG - Intergenic
1030902396 7:115140609-115140631 AAGGGGAAGGAGAACGGGAAGGG - Intergenic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1032098282 7:128951174-128951196 AAGAGGGAGTAGAACTGCACAGG - Intergenic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032799997 7:135310263-135310285 CTAAGGAAGGAGAACTGGCCTGG + Intergenic
1035464960 7:159068945-159068967 CAGCAGAAAGAGAACTGCACAGG + Intronic
1035886452 8:3296352-3296374 CAGAGGAAGGGGGACTGGGAAGG + Intronic
1035925850 8:3726740-3726762 CTCAGGAATGAGAACTGGACTGG - Intronic
1036288349 8:7464085-7464107 GTGAGGAAGGAGAAGTGGAGGGG - Intergenic
1036333126 8:7847443-7847465 GTGAGGAAGGAGAAGTGGAGGGG + Intergenic
1036445379 8:8817606-8817628 CACAGCAAGGAGAACAGGAGGGG - Intronic
1036659876 8:10701013-10701035 CAGAGGTCGGAGACCTGGCCTGG + Intronic
1036956768 8:13196175-13196197 TAGGGGAAGGAGAATAGGACTGG + Intronic
1039540979 8:38369338-38369360 CAGTGGAAGTAAAATTGGACTGG + Intronic
1039957287 8:42217404-42217426 GAGAGGAAGGAGAATCGAACAGG + Intergenic
1040564053 8:48550212-48550234 AAGTGGCAGGAGCACTGGACTGG - Intergenic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1041004021 8:53481998-53482020 CAGTGGCAGTAGAAATGGACAGG + Intergenic
1041566691 8:59286633-59286655 GAGAAGAAGTAGAACTGGAGGGG - Intergenic
1042030366 8:64469560-64469582 CAGAGGAAGGAGAAAGGTAGAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043670154 8:82874559-82874581 TGGAGGAAGGAGAAGAGGACTGG + Intergenic
1044420874 8:91994505-91994527 TAGTGGAAAGAGCACTGGACTGG + Intronic
1044848739 8:96407336-96407358 CAAAGGAAGGAAAAGTGGAATGG + Intergenic
1044935849 8:97292900-97292922 TAGGGGAGGGAGCACTGGACTGG - Intergenic
1044965181 8:97567638-97567660 TAGAGGCATGAGAACTGGAAAGG - Intergenic
1045292913 8:100849135-100849157 CAGAGGAAGGAGAGCTTGGGAGG + Intergenic
1046396829 8:113651152-113651174 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1047316640 8:123740973-123740995 CTGAGGAAGGAGAAAAGGAGGGG - Intergenic
1047735628 8:127762560-127762582 AAGAGGAAGGAGGCCTGGACTGG + Intergenic
1048408293 8:134145282-134145304 CAGAGGAAGGACTCCTGGCCTGG + Intergenic
1049197489 8:141323764-141323786 CAGAGAAAGAGGAACTGGCCAGG + Intergenic
1049266725 8:141671563-141671585 CACAGGCAGGAGGACTGGAAAGG - Intergenic
1049389378 8:142360218-142360240 CAGAGGAGGGAGGGCTGGGCAGG + Intronic
1050305602 9:4302383-4302405 CTGATGAATGAGAACTGGACTGG - Intronic
1050462376 9:5887490-5887512 CAGAGGAGGGAGTACTGACCTGG - Intronic
1050519173 9:6479235-6479257 CAGTGGAAGGAAAGCTAGACTGG - Intronic
1050942181 9:11473235-11473257 AAGATGAAGGAGAAGTGGAGAGG + Intergenic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1051698048 9:19789631-19789653 GACAGGAAGGAGCACTGGGCTGG - Intergenic
1051901739 9:22050354-22050376 CAGAGGAAGAAAAACTGAAAAGG - Intergenic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1053880611 9:42590500-42590522 CTGAGGCAGGAGAATTGCACAGG - Intergenic
1053892059 9:42703830-42703852 CTGAGGCAGGAGAATTGCACAGG + Intergenic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1056069742 9:82973776-82973798 AAGAGAAAGGAGAATTGGAAGGG - Intergenic
1056267861 9:84917396-84917418 CAGTGGAAGGAGCACTGGGCCGG + Intronic
1056893985 9:90523526-90523548 CAGGGGAAGGAAAAATGGAATGG + Intergenic
1057911986 9:99026415-99026437 TACAGGAAGGTGAACTGGGCAGG - Intronic
1058349925 9:104009458-104009480 GAGAGGAAGGAGAACTTGTCAGG - Intergenic
1058802870 9:108561857-108561879 CCAAGGCAGGAGAATTGGACAGG - Intergenic
1059202388 9:112430280-112430302 CAGAGGAAGCAGCAGTGGATAGG + Intronic
1059468464 9:114484901-114484923 CAGAGGAGTGAGAAATAGACTGG + Intronic
1059777377 9:117489054-117489076 CAGAAGAAGAGGAACTGGGCTGG - Intergenic
1060098788 9:120818949-120818971 CAGAGGAAGGGGAATAGGACTGG + Intronic
1060150116 9:121283031-121283053 CTGAGGAAAGAGCACTGGATTGG - Intronic
1060469048 9:123931950-123931972 CTGAGGAGAGAGCACTGGACTGG + Intergenic
1060688255 9:125631898-125631920 TAGAGGAAGGACACCTGGCCTGG - Intronic
1060921341 9:127422623-127422645 GAGAGGAAGCATAACTAGACTGG - Intergenic
1061308484 9:129746714-129746736 GGGAGGACGGAGAGCTGGACAGG - Intronic
1061482324 9:130903249-130903271 CAGAGGCAGGAGAAATGGGATGG + Exonic
1061521617 9:131121580-131121602 CAGAGGGAGGTGCCCTGGACTGG + Exonic
1061713552 9:132504212-132504234 CAGAGTGAGGAGCACTGGATGGG - Intronic
1061889599 9:133610901-133610923 AAGAGGAAGGAGGACTAGCCTGG - Intergenic
1061959382 9:133980235-133980257 CAGAGGCAAGAGACCTGCACGGG + Intronic
1062355035 9:136157937-136157959 CAGAGGAAGGAGCTCTGACCTGG - Intergenic
1062701061 9:137903520-137903542 AAAAGCAAGGAGAACGGGACTGG - Intronic
1185975399 X:4714224-4714246 CAGCAGAAGGGGAACTGGAAAGG - Intergenic
1187370488 X:18701744-18701766 CAGGGGATGTAGAGCTGGACAGG - Intronic
1187645012 X:21337967-21337989 CAGAGCAAAAAGAACTGAACTGG + Intergenic
1187680986 X:21767724-21767746 CAGGGGAAGAAGATCTGGGCAGG + Intergenic
1189038553 X:37517928-37517950 GAGAGGAAGCAAAACTGGGCAGG - Intronic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189110593 X:38286077-38286099 AAGAGGAAGGAGAAGGGGAAGGG - Exonic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189486219 X:41434561-41434583 GACAGGAAGGAAAACAGGACAGG + Intergenic
1190474592 X:50814002-50814024 CCGAGGATGGAGAACCGGCCTGG - Exonic
1192195703 X:69026493-69026515 CAGAGGAAGGAGAATACGAGTGG + Intergenic
1192289216 X:69774314-69774336 CACAGGACGGAGTACTGGAGAGG - Intronic
1192550715 X:72051560-72051582 AAGAGGAAGGAGGGCTGGATAGG - Intergenic
1193143915 X:78057975-78057997 CAGAGGTAGGAAGACTGGAAGGG + Intergenic
1194374876 X:93119981-93120003 CAAAGGAAGTAGATCTGGGCAGG + Intergenic
1196013721 X:110915531-110915553 CAGAGGGAAGAGAAATGGAAAGG - Intergenic
1196650495 X:118163829-118163851 TAGAAGAAGGAGCACTGGATTGG - Intergenic
1197164451 X:123361234-123361256 CAGAAGAAGAAGACCTGGAAGGG - Intronic
1197518726 X:127471654-127471676 CAGAGGAATGTGACCTAGACAGG - Intergenic
1198103528 X:133441473-133441495 GAGTGGAAGGAGCACTGGACTGG + Intergenic
1198368943 X:135973135-135973157 CAGGAGAAAGAGCACTGGACTGG - Intronic
1200160857 X:154008010-154008032 CAGAGGAAGAGGGACTGCACAGG + Intergenic
1200682897 Y:6234046-6234068 CATAGGAAGTAGATCTGGGCAGG + Intergenic