ID: 1158431146

View in Genome Browser
Species Human (GRCh38)
Location 18:57388751-57388773
Sequence CTGGTTTTTTACTCTTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158431146_1158431150 23 Left 1158431146 18:57388751-57388773 CCTTCATAAGAGTAAAAAACCAG No data
Right 1158431150 18:57388797-57388819 TAACTTCACATTGCTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158431146 Original CRISPR CTGGTTTTTTACTCTTATGA AGG (reversed) Intergenic
No off target data available for this crispr