ID: 1158433903

View in Genome Browser
Species Human (GRCh38)
Location 18:57419760-57419782
Sequence TTAACGATGTTAGCTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158433903_1158433908 26 Left 1158433903 18:57419760-57419782 CCTGGAAGAGCTAACATCGTTAA No data
Right 1158433908 18:57419809-57419831 GCATGTTCTCACTCATAAGTGGG 0: 3042
1: 15498
2: 23695
3: 15543
4: 9593
1158433903_1158433907 25 Left 1158433903 18:57419760-57419782 CCTGGAAGAGCTAACATCGTTAA No data
Right 1158433907 18:57419808-57419830 CGCATGTTCTCACTCATAAGTGG 0: 1267
1: 11027
2: 23422
3: 18198
4: 12238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158433903 Original CRISPR TTAACGATGTTAGCTCTTCC AGG (reversed) Intergenic
No off target data available for this crispr