ID: 1158434655

View in Genome Browser
Species Human (GRCh38)
Location 18:57427755-57427777
Sequence AGCCCGGCCGCGGCCTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 217}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158434650_1158434655 -8 Left 1158434650 18:57427740-57427762 CCCGGTCCGGCCTGGAGCCCGGC 0: 1
1: 0
2: 2
3: 29
4: 269
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434638_1158434655 27 Left 1158434638 18:57427705-57427727 CCGACCGGCGCGGCCCCACCATC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434639_1158434655 23 Left 1158434639 18:57427709-57427731 CCGGCGCGGCCCCACCATCCGCT 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434645_1158434655 5 Left 1158434645 18:57427727-57427749 CCGCTGACCTTCGCCCGGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434640_1158434655 14 Left 1158434640 18:57427718-57427740 CCCCACCATCCGCTGACCTTCGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434642_1158434655 12 Left 1158434642 18:57427720-57427742 CCACCATCCGCTGACCTTCGCCC 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434644_1158434655 9 Left 1158434644 18:57427723-57427745 CCATCCGCTGACCTTCGCCCGGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434641_1158434655 13 Left 1158434641 18:57427719-57427741 CCCACCATCCGCTGACCTTCGCC 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434651_1158434655 -9 Left 1158434651 18:57427741-57427763 CCGGTCCGGCCTGGAGCCCGGCC 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434648_1158434655 -2 Left 1158434648 18:57427734-57427756 CCTTCGCCCGGTCCGGCCTGGAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158434655 Original CRISPR AGCCCGGCCGCGGCCTCCCT AGG Intergenic