ID: 1158434655

View in Genome Browser
Species Human (GRCh38)
Location 18:57427755-57427777
Sequence AGCCCGGCCGCGGCCTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 217}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158434651_1158434655 -9 Left 1158434651 18:57427741-57427763 CCGGTCCGGCCTGGAGCCCGGCC 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434645_1158434655 5 Left 1158434645 18:57427727-57427749 CCGCTGACCTTCGCCCGGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434640_1158434655 14 Left 1158434640 18:57427718-57427740 CCCCACCATCCGCTGACCTTCGC 0: 1
1: 0
2: 0
3: 5
4: 151
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434638_1158434655 27 Left 1158434638 18:57427705-57427727 CCGACCGGCGCGGCCCCACCATC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434648_1158434655 -2 Left 1158434648 18:57427734-57427756 CCTTCGCCCGGTCCGGCCTGGAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434644_1158434655 9 Left 1158434644 18:57427723-57427745 CCATCCGCTGACCTTCGCCCGGT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434639_1158434655 23 Left 1158434639 18:57427709-57427731 CCGGCGCGGCCCCACCATCCGCT 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434642_1158434655 12 Left 1158434642 18:57427720-57427742 CCACCATCCGCTGACCTTCGCCC 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434650_1158434655 -8 Left 1158434650 18:57427740-57427762 CCCGGTCCGGCCTGGAGCCCGGC 0: 1
1: 0
2: 2
3: 29
4: 269
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217
1158434641_1158434655 13 Left 1158434641 18:57427719-57427741 CCCACCATCCGCTGACCTTCGCC 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158434655 Original CRISPR AGCCCGGCCGCGGCCTCCCT AGG Intergenic
900205193 1:1428363-1428385 AGCCCGGCTGCCGCCACCCCTGG - Intergenic
900266130 1:1758085-1758107 AGCCCCGCTGCGCCCTCCCTTGG - Intronic
900338067 1:2174578-2174600 AGTCCCGCCGGGTCCTCCCTGGG - Intronic
900349710 1:2228611-2228633 ATCACGGCCGCGGCCTCGCCCGG - Intergenic
900636395 1:3668085-3668107 AGCCAGGCACCAGCCTCCCTGGG + Intronic
901577016 1:10209889-10209911 AGCCCTTCCGCGGTCTCCCAAGG + Intergenic
908951674 1:69568684-69568706 GGCCCGGCCGCGGCGACCGTAGG + Intronic
910258737 1:85276255-85276277 AGCCCGCCCCCGCCCGCCCTGGG + Intronic
912393722 1:109323170-109323192 AGCCTGGCAGCTGCCTCCCGTGG - Intronic
915733413 1:158069705-158069727 AGCCAGGCCACTGGCTCCCTTGG - Intronic
917788795 1:178486742-178486764 AGCCCTGCTGCGGCCTCTCGGGG - Intergenic
918064276 1:181089116-181089138 GGCCCGGCCGCCGGCTCCCCGGG - Exonic
919463242 1:197902937-197902959 CGCCCCGCCGCGGCCGCCCCGGG + Intronic
921068729 1:211641637-211641659 AACCCAGCCCAGGCCTCCCTGGG - Intergenic
922196504 1:223364262-223364284 AGCCCGGCCGCGCGCCCCCGCGG + Intergenic
922730601 1:227947168-227947190 GGCCCGGCCGGGGCGTCCCGCGG - Intronic
922798374 1:228352803-228352825 AGCCCCGCCACAGCATCCCTGGG - Intronic
924521666 1:244811229-244811251 AGCCTGGCCTCTGCCTCCATAGG - Intergenic
1062799984 10:371728-371750 GGCCTGACCGCAGCCTCCCTCGG - Intronic
1064231003 10:13529113-13529135 AGCCCGGCCGCCGCCATCCCCGG + Intergenic
1066649409 10:37640440-37640462 TGCCTGGCCGCCCCCTCCCTGGG - Intergenic
1067052015 10:43026964-43026986 GGCCTGGCCGAGGACTCCCTCGG - Intergenic
1068783442 10:60944763-60944785 AGCCCAGCCTCCTCCTCCCTGGG + Intronic
1070846183 10:79524138-79524160 TGCCCTGCCCCGGCCTTCCTGGG + Intergenic
1070927615 10:80236172-80236194 TGCCCTGCCCCGGCCTTCCTGGG - Intergenic
1075132083 10:119748730-119748752 AGGCCGTCCGTGGCCTCCCATGG - Intronic
1075713645 10:124543593-124543615 AGCCCAGCCGCCGCCACCATGGG - Intronic
1076698417 10:132257890-132257912 TGCTGGGCCGCGGCCTCCTTTGG - Intronic
1076859407 10:133133558-133133580 ACCCCGTCCCCTGCCTCCCTGGG - Intergenic
1077214687 11:1390444-1390466 TTCGCGGCCGGGGCCTCCCTCGG - Intronic
1077610062 11:3638655-3638677 AGCCCTGCTGTGGCCTCCCCAGG + Exonic
1077976225 11:7251722-7251744 AGCCAGGGCGCGGCCGCTCTGGG + Intronic
1080791432 11:35525635-35525657 CGCCTGCCCCCGGCCTCCCTGGG - Intronic
1081870806 11:46381783-46381805 CGCCCGGCCGCGGCCGATCTAGG + Intronic
1083900270 11:65640255-65640277 TGCCCTGCCGCTGCCTCCCTGGG + Exonic
1084165470 11:67373108-67373130 CGCCCGGCCTCGGGCTCCCCCGG + Intronic
1085512612 11:77095922-77095944 AGACCCGCCCTGGCCTCCCTGGG - Intronic
1088462157 11:110093278-110093300 AGCCCCGGCGCCCCCTCCCTGGG - Intergenic
1090626766 11:128615090-128615112 AGCCCCGGCTCTGCCTCCCTGGG - Intergenic
1090788617 11:130070448-130070470 AGCCCAGCCGCGGACTCCGGCGG - Intronic
1091588108 12:1827566-1827588 GGCCTGGCCCCTGCCTCCCTCGG + Exonic
1097114546 12:56687944-56687966 AACGCGGCCTCGGCCTCACTCGG + Intronic
1102501814 12:113358517-113358539 AGCCCGGCCCCGCCCGCCCTCGG + Intronic
1103649460 12:122422112-122422134 CGCCCGGCTTCGGCCTCCCGGGG + Intronic
1103722235 12:122981071-122981093 AGCCCGCCCGCGGCCGGCCTTGG + Exonic
1104460069 12:128948104-128948126 AGCCCAGCCAGGGCCTGCCTGGG - Intronic
1104860839 12:131922592-131922614 AACCCCGCCTGGGCCTCCCTTGG + Exonic
1104952849 12:132450240-132450262 AGCCGGGCCTGGGCCTTCCTGGG - Intergenic
1105943378 13:25170594-25170616 CGCCCGGCCGCTGCCGCCTTCGG + Exonic
1106683430 13:32031521-32031543 AGCGCGGCCGCCGCCTCCGAGGG + Exonic
1108292506 13:48975844-48975866 GTCCCGGCCGCGGGCTCCGTCGG + Intergenic
1110567623 13:76972149-76972171 CCCCCGGCCTCGGCCTCCCAGGG - Intergenic
1113185681 13:107683671-107683693 AGTCCTGCCACGGCCTCTCTGGG - Intronic
1113808643 13:113124134-113124156 AGCCCGGCCCGGGGCTCCCGAGG + Intronic
1113923590 13:113928349-113928371 TGCCCGGCCACGGCCTCCACAGG - Intergenic
1114558568 14:23576258-23576280 AGCCCCGCCTCGGGCTCCCGGGG - Exonic
1115544734 14:34455473-34455495 ACCCCTGCCTCGGCCACCCTGGG - Intronic
1117920728 14:60723472-60723494 CGGCCGGCCGCGGGCTCGCTCGG + Exonic
1119616188 14:76100628-76100650 AGCCTGCCCGCACCCTCCCTGGG + Intergenic
1121313979 14:92950266-92950288 AGTCCTGCCTTGGCCTCCCTGGG - Intronic
1122270792 14:100567782-100567804 AGCCCCGCCGAGGCCGCCCGCGG + Intronic
1122523474 14:102363178-102363200 AGCCCCTCCTCGGCCTCCCCCGG + Intronic
1122688983 14:103522726-103522748 AGCCCGGGCGCGGACGCCCCCGG + Intronic
1123110485 14:105864798-105864820 AGCCCGGCCACCGTCTCCCTGGG - Intergenic
1124249306 15:28096794-28096816 AGCCCACCCGCGGCCTCCCGAGG - Intronic
1124354183 15:28983202-28983224 AGCCCAGCCGCCGTCTCCCTGGG + Intronic
1124497620 15:30196121-30196143 CGCCCGGCGGCGGCCTCGCGGGG + Intergenic
1124745969 15:32342570-32342592 CGCCCGGCGGCGGCCTCGCGGGG - Intergenic
1124973713 15:34514637-34514659 CGCCCGGCGGCGGCCTCGCGGGG - Intergenic
1128374603 15:67066054-67066076 AGCTCGGCCGGGGCCTGCCGCGG - Exonic
1128758014 15:70196391-70196413 AGCCCGGCCCCCTCCTCCCCTGG + Intergenic
1129348102 15:74937563-74937585 AGGCCGGCGGCGGCCACTCTCGG + Intronic
1129483215 15:75843853-75843875 CGCCCGGCCGCGGCCCCGCGGGG + Intronic
1129718849 15:77866801-77866823 TGCCCAGCAGGGGCCTCCCTGGG + Intergenic
1130460080 15:84154059-84154081 TGCCCAGCAGGGGCCTCCCTGGG - Intergenic
1132551004 16:553793-553815 AGCCTGGCCTCGGCCCCCGTCGG - Exonic
1132660368 16:1058338-1058360 AGCCCAGCGCCGGCCTCCCTGGG - Intergenic
1132681775 16:1145402-1145424 AGCCAGGAGGGGGCCTCCCTCGG + Intergenic
1132942164 16:2513778-2513800 CGCCCGGCCCCGCCCTGCCTCGG - Intronic
1133018462 16:2955576-2955598 AGACCAGCTGCGGCCTTCCTGGG + Intergenic
1133300206 16:4777867-4777889 AACCTGGCCCCGGCCTCCCCAGG - Exonic
1136396480 16:29995298-29995320 AGCCCCGCCTCCGCCTCCCGCGG + Exonic
1136550338 16:30979463-30979485 AGCCCGGCTCCGGCCTCCTCGGG - Exonic
1136684572 16:31986622-31986644 AGCCCTGCTGCTCCCTCCCTGGG - Intergenic
1136785196 16:32930158-32930180 AGCCCTGCTGCTCCCTCCCTGGG - Intergenic
1136884586 16:33923646-33923668 AGCCCGGCTGCTCCCTCCCTGGG + Intergenic
1137665218 16:50245902-50245924 TGCCCGGCCGCTCCCTCCCGCGG + Intergenic
1138686962 16:58734193-58734215 ACTCCGGCCGCGTCCTCCCCGGG - Exonic
1139484608 16:67248672-67248694 TGCGCGGCCACGGCCCCCCTGGG - Intronic
1140212996 16:72985484-72985506 AGCTCTGCCTCGCCCTCCCTGGG - Intronic
1141426505 16:83947737-83947759 AGGCCTCCCTCGGCCTCCCTCGG - Intronic
1141720105 16:85751191-85751213 GGCCCGCCCGTCGCCTCCCTGGG + Intergenic
1203087856 16_KI270728v1_random:1194167-1194189 AGCCCTGCTGCTCCCTCCCTGGG - Intergenic
1142550102 17:732913-732935 AGCCCCTCCGCGTCCTCCCCTGG + Intronic
1143101396 17:4506585-4506607 AGCCCGGCCCCGCCCACTCTTGG + Intronic
1143150766 17:4806857-4806879 TGCCCGGCCGCTGCCTCCCGGGG - Intergenic
1147145507 17:38482303-38482325 AGCCCTGCTGCTCCCTCCCTGGG - Intronic
1148642914 17:49201586-49201608 AGCCCAGCCCCGCCCACCCTTGG - Intergenic
1150300959 17:64046611-64046633 GGCCAGGCAGCGTCCTCCCTAGG + Intronic
1150426019 17:65077681-65077703 AGCCCAGCCTCGATCTCCCTGGG - Intergenic
1150802411 17:68292089-68292111 GGCCCGGCCGCTCGCTCCCTGGG - Intronic
1151453312 17:74212390-74212412 AGCCCCGCCCCGTCCTCCCGGGG + Intergenic
1151579916 17:74972089-74972111 TGCGCGGCAGCGGCCTCGCTGGG - Intronic
1151620282 17:75240868-75240890 AGCCAGGCCGAGGCCACCCTGGG - Exonic
1151827323 17:76530593-76530615 AGCCCAGCCACTTCCTCCCTGGG - Intronic
1151994149 17:77598033-77598055 GGCCTGGCCGCCGCCTCTCTGGG + Intergenic
1152593930 17:81229193-81229215 AGTCTGGCCTCGGCCTCGCTGGG + Exonic
1152642343 17:81454481-81454503 AGCCCGGCAACGGGGTCCCTGGG + Intronic
1152743377 17:82028339-82028361 AGCCCTGCCGCGCCCACCCTGGG - Intronic
1152824808 17:82458309-82458331 AGCCCGGCCGCGGCCTCCGCGGG + Intronic
1153024158 18:658181-658203 AGCCCGGCCGCGGAGCCGCTGGG - Exonic
1154147078 18:11875211-11875233 AGCTGGGCCCTGGCCTCCCTGGG - Intronic
1155072792 18:22330900-22330922 AGACAGGCATCGGCCTCCCTGGG - Intergenic
1156499821 18:37550648-37550670 AGCCCGTCCGCTGGCTGCCTGGG + Intronic
1157496750 18:48161939-48161961 CGCCGGGCCGCGGCCTCCCGGGG - Intronic
1157610147 18:48950732-48950754 AACCCGGCCGCCGCTTCCCTGGG + Intergenic
1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG + Intergenic
1160683785 19:424230-424252 CGCCCGGCTGGGGGCTCCCTCGG + Intronic
1160909870 19:1469469-1469491 GGCCCGGCAGCGGCCCCCCGCGG + Exonic
1161067281 19:2244877-2244899 AGCCTGGCCTGAGCCTCCCTGGG + Intronic
1161391711 19:4024522-4024544 AACCCGGGCGAGACCTCCCTGGG + Intronic
1162363117 19:10231260-10231282 GCCCCAGCCGCGGCCGCCCTGGG - Exonic
1162810739 19:13163180-13163202 AGCTCCGCCCCCGCCTCCCTGGG - Intergenic
1162819107 19:13212136-13212158 AGCCCGGCCCTGGCCTTCCATGG + Exonic
1164835250 19:31351468-31351490 AGCCCCGCCGCAGCCCGCCTCGG - Intergenic
1165058611 19:33194394-33194416 CGCCCGGCCCCGGCGTCCCCGGG - Intronic
1165058639 19:33194459-33194481 AGCCCCGCCGCGGCCGGCCTGGG - Intronic
1165859390 19:38899413-38899435 CGCCCCACCGCGGCCACCCTTGG + Intronic
1166998146 19:46729587-46729609 AGCCCGGCCGCTGCCTTTCTGGG - Intronic
1167363382 19:49042240-49042262 GGCCCGGCAGCGGCACCCCTAGG - Intergenic
1167427564 19:49437294-49437316 AGCCCGTCCCAGGCATCCCTAGG + Intronic
1168064005 19:53909323-53909345 CCCGCGGCCGCGGCCTCACTCGG - Exonic
1168084396 19:54034767-54034789 AGCCCGGGCTGGGCCTCCCTGGG - Intergenic
925033132 2:666730-666752 AGCCCAGCCCCGTCCTCCCCAGG + Intergenic
928186593 2:29115805-29115827 AGCCCCGCGGCCGCCTCCCGTGG + Intronic
929963025 2:46510860-46510882 TGCCTGGCCGGGTCCTCCCTTGG - Intronic
932238896 2:70142220-70142242 AGCCAGGCCCCGCCCTACCTGGG - Intergenic
932620888 2:73264491-73264513 ACCCCGCCCACTGCCTCCCTCGG + Exonic
935361593 2:102250701-102250723 AGCCAGGCCGCGGGGACCCTAGG + Intergenic
936427325 2:112432940-112432962 GGCCCGGCGGCGGCCTCGATGGG - Intronic
936427379 2:112433118-112433140 GGCCCGGCGGCGGCCTCGATGGG - Intronic
936427405 2:112433208-112433230 GGCCCGGCGGCGGCCTCGATGGG - Intronic
936427432 2:112433298-112433320 GGCCCGGCGGCGGCCTCGATGGG - Intronic
937237985 2:120442152-120442174 GGCAGCGCCGCGGCCTCCCTGGG - Intergenic
938319793 2:130355527-130355549 TGCCCCTCCCCGGCCTCCCTTGG + Intergenic
944906401 2:204266103-204266125 AGGCCAGCGGCAGCCTCCCTGGG - Intergenic
945404039 2:209423917-209423939 AGCCCCGCCGCGGCCGCCCACGG + Intergenic
946235671 2:218323194-218323216 GGCCCGGCCCCGGCCCCCCGCGG - Intronic
947651071 2:231786617-231786639 GGCACGGCCGCGGGCTTCCTTGG - Intronic
948607203 2:239143746-239143768 AGCCCCTCCCCGGCTTCCCTAGG + Intronic
1171184850 20:23117989-23118011 AGCCCTGCCCAGACCTCCCTTGG + Intergenic
1171391549 20:24804658-24804680 TGCCAGGCCATGGCCTCCCTCGG - Intergenic
1172702830 20:36863390-36863412 CGCCCGGCCTCGACGTCCCTGGG + Exonic
1173662833 20:44745920-44745942 AGCCCGGCCGCGCGCACGCTCGG - Exonic
1175935542 20:62512208-62512230 AGCCCGGCCGAGGCCTGTCTCGG + Intergenic
1176086481 20:63297608-63297630 AGCCAGGCTGGGGCCTCCCTGGG + Intronic
1176221135 20:63969822-63969844 GGCCCGGCCGCAGCCCCGCTGGG - Intronic
1178922588 21:36748115-36748137 AGCCTGGACCCGGCCTCCCGGGG + Exonic
1178992604 21:37367639-37367661 GGCCCGGCCGCGGCCCCGCCCGG + Intronic
1179563985 21:42235009-42235031 AGCGGGGTCGCAGCCTCCCTGGG + Intronic
1179891816 21:44339086-44339108 GGCCTGGCCGCGGCCGCCCCGGG - Intronic
1182106796 22:27695464-27695486 ACCACAGCCTCGGCCTCCCTGGG - Intergenic
1184274154 22:43400640-43400662 AGCCCGGCTGCTGCCTCCCTGGG - Intergenic
1185080920 22:48708880-48708902 AGCCCAGCCGAGCCCTCTCTTGG - Intronic
1185245741 22:49771824-49771846 CCCCCGACAGCGGCCTCCCTGGG + Intergenic
1185315893 22:50178977-50178999 AGCCCGGGCAGGGCTTCCCTCGG + Exonic
951611450 3:24495508-24495530 ATCCCGGCCGTGCCCTCCCAGGG + Intergenic
953138502 3:40205083-40205105 AGCCCCCCTTCGGCCTCCCTTGG + Intronic
953589894 3:44241761-44241783 GGCGCGGCCACTGCCTCCCTCGG + Intergenic
953705303 3:45226111-45226133 CGCCCGGCCGCCGGCTCCCGCGG - Exonic
955768571 3:62369081-62369103 AGCCCGGGCGCGCCCTCCGGCGG + Intergenic
956707438 3:72011506-72011528 AGCCCAGCCACAGACTCCCTGGG + Intergenic
960937599 3:122913107-122913129 ACCCCGGCCTGGGCCTCCCCGGG + Intronic
960988419 3:123295296-123295318 GGCCCGGCCTCTGCCTCTCTTGG - Intronic
961345143 3:126259453-126259475 AGCCAGGCCGCGCCCTCCCGGGG - Intergenic
961826737 3:129603185-129603207 ATTCCGGCTGCGGCCTTCCTTGG - Intronic
962808625 3:138944403-138944425 AACCCGGCAGCGGCCGACCTAGG - Exonic
964478163 3:157115740-157115762 AGCCCAGCCACTGACTCCCTTGG - Intergenic
968230476 3:197002556-197002578 ACCCAGGCCGCGGGCTCCCGAGG - Exonic
968742853 4:2340100-2340122 AGCCCGGCTGCTTCATCCCTGGG - Intronic
969369286 4:6720992-6721014 AGCCCAGCTCCCGCCTCCCTTGG + Intergenic
972321572 4:37977413-37977435 AGCCCGCCCCCGGCCGCCCGCGG + Intronic
982962155 4:161853509-161853531 ACACCTGCCTCGGCCTCCCTCGG + Intronic
985363612 4:189202401-189202423 TGCCAGGCCGCGGCTCCCCTGGG - Intergenic
985520949 5:373717-373739 GACCCGGCCACGGCCTCCCCAGG - Intronic
985580659 5:693742-693764 AGCGCGGCCGCGGCCTCCTGGGG + Intergenic
985595283 5:785074-785096 AGCGCGGCCGCGGCCTCCTGGGG + Intergenic
986495010 5:8332830-8332852 AGCCCTGCCGCGGGCTCCCCAGG - Intergenic
986498676 5:8374462-8374484 AGGCTGGACGCAGCCTCCCTGGG - Intergenic
992102375 5:73419768-73419790 AGCCGGGCCTCGCCCTCCCCCGG - Intergenic
992762384 5:79962199-79962221 AGGCCGGCAGCGGCCTTCCTTGG + Intergenic
999327396 5:150651576-150651598 AGCCCAGCCCAGGCATCCCTTGG - Exonic
1002139971 5:177132702-177132724 CGCCCGGCCGTGGCCTCCGCGGG - Intergenic
1002352126 5:178590437-178590459 AGCCCGGCCGCTCCTCCCCTGGG - Exonic
1006450846 6:34104905-34104927 AGCCCCGCCCCTGCCTCCCACGG - Intronic
1006813353 6:36835115-36835137 CGCCCCGCCGCGTCTTCCCTGGG + Intronic
1007383508 6:41505104-41505126 CGCCCGGCCAAGGCCGCCCTGGG + Intergenic
1011583912 6:88903292-88903314 AGCCCAGCCTTGACCTCCCTGGG - Intronic
1018679665 6:166253467-166253489 AGCCCGGCGGCCGCCACCCCAGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019365302 7:629825-629847 AGCGGGGCCACGGCCTCCCAGGG + Intronic
1019365320 7:629881-629903 AGCAGGGCCACGGCCTCCCAGGG + Intronic
1019365339 7:629937-629959 AGCGGGGCCACGGCCTCCCAGGG + Intronic
1019365358 7:629993-630015 AGCGGGGCCACGGCCTCCCAGGG + Intronic
1019419759 7:945562-945584 AGCCATGCCGCAGCCACCCTTGG - Intronic
1019578835 7:1750259-1750281 AGCCCGGCCCCGGCCCCCCGGGG + Intergenic
1019610364 7:1933652-1933674 AGGTCGGCCGCTGCCTCCCTGGG - Intronic
1019713204 7:2526724-2526746 GGCCCTGCCCTGGCCTCCCTTGG - Intronic
1021845505 7:24758622-24758644 AGCCCGGCAGCGCTTTCCCTTGG + Intergenic
1023401107 7:39793375-39793397 TGCCCCACCGCGGCCTCCCGGGG - Intergenic
1024070106 7:45777628-45777650 AGCCCGGCAGTGCCTTCCCTTGG + Intergenic
1024301144 7:47888730-47888752 AGCCCGGCGCCCACCTCCCTTGG + Intronic
1024771294 7:52726277-52726299 AGCCCCGCTGCAGCCTCCCCAGG - Intergenic
1025129297 7:56367415-56367437 AGCCCCGCTGTGGCCTCCCAGGG + Intergenic
1025976866 7:66377050-66377072 TGCCCGGCCGCGGCCTCCCCAGG - Intronic
1029460957 7:100693832-100693854 AGCCGGGCGCCGGCCTCCCGGGG + Intergenic
1030076742 7:105743397-105743419 AGCCAGCCGGCAGCCTCCCTGGG - Intronic
1031629950 7:124033323-124033345 AGCCCCGGCGCCGCCTCCCCTGG - Intergenic
1032047497 7:128621911-128621933 AGCCCGGCAGTGCCTTCCCTTGG + Intergenic
1032530453 7:132615455-132615477 TGCCCGGCCTCAGCGTCCCTGGG + Intronic
1034414068 7:150955784-150955806 AGCCCAGCAGCGGCCGCACTCGG + Intronic
1034967462 7:155400130-155400152 AGCCCGGCCCCGGGCACCGTGGG - Intergenic
1035266885 7:157693921-157693943 AGACCGCACGCGGCCACCCTGGG + Intronic
1035279636 7:157769611-157769633 AGCCACGCCACGGGCTCCCTTGG + Intronic
1035601907 8:902173-902195 AGCCCGGCCGCTCCCCTCCTCGG + Intergenic
1035747695 8:1973947-1973969 GGCCCCGCCGCTGCCTCCCCGGG - Intronic
1036910831 8:12755568-12755590 AGCCCGGCCCCGCCCTCGCCAGG - Intronic
1037769210 8:21789159-21789181 AGCCCAGCCGCCGGCTCCCTCGG + Intronic
1042278363 8:67028657-67028679 CGCCCGGCCGCCGCCTCACAGGG - Intronic
1042894394 8:73651118-73651140 AGGCCTGCCGAGGTCTCCCTGGG + Intronic
1043969595 8:86514738-86514760 AGCCAGGCCGCGACCTAGCTCGG - Intronic
1045211680 8:100106097-100106119 TGGCCGGCCTCGGCCTCCCTGGG - Exonic
1047506745 8:125486259-125486281 CACCCGGGCGCTGCCTCCCTCGG + Intergenic
1047732288 8:127737376-127737398 TCCCCTGCCGCGGCCGCCCTCGG + Intronic
1049098470 8:140562679-140562701 TGCCAGGCTGCGTCCTCCCTGGG - Intronic
1050304976 9:4298206-4298228 AGCCCGGCCGTGGCGCCCCCGGG - Intronic
1052883822 9:33624090-33624112 AGCTCTGCCTCGGCCTGCCTGGG - Intergenic
1058467591 9:105244766-105244788 TGCCAGGCCGCGCCCTCCCCGGG + Exonic
1061904774 9:133690989-133691011 AGCCTGGCTGGGGCCTGCCTGGG - Intronic
1061975952 9:134068116-134068138 CGCGCGCCCGCGGCCTCCCCTGG - Intronic
1062139539 9:134948252-134948274 AGCTCTGCCGCGGCTTTCCTGGG - Intergenic
1062165519 9:135105543-135105565 GGCCAGGCCGCGTCCTCCCGGGG + Intronic
1062464216 9:136674028-136674050 AGCCCGGCCTCGGGCTTCCCAGG - Intronic
1062475672 9:136725785-136725807 AGCCCCGCCCCCGCCCCCCTGGG + Intergenic
1187950407 X:24465260-24465282 GGGCCGCCCGCGGCTTCCCTAGG - Intronic
1189711869 X:43821419-43821441 ATCCCGGCTGCAGCCTCACTGGG + Intronic
1200032387 X:153306983-153307005 AGCCCGGCTCCTGCCTGCCTGGG - Intergenic
1201178208 Y:11322469-11322491 AGCCCCACCGCGGACTCCCCTGG - Intergenic
1202379170 Y:24261114-24261136 TGCCCAGCAGGGGCCTCCCTGGG + Intergenic
1202491612 Y:25409007-25409029 TGCCCAGCAGGGGCCTCCCTGGG - Intergenic