ID: 1158436975

View in Genome Browser
Species Human (GRCh38)
Location 18:57440723-57440745
Sequence CCTTGGGTGACACGGGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158436963_1158436975 14 Left 1158436963 18:57440686-57440708 CCGCGTGCGTGCTTGTCTCCCGC No data
Right 1158436975 18:57440723-57440745 CCTTGGGTGACACGGGCCGCTGG No data
1158436968_1158436975 -5 Left 1158436968 18:57440705-57440727 CCGCTGCGCCGGGGACGTCCTTG No data
Right 1158436975 18:57440723-57440745 CCTTGGGTGACACGGGCCGCTGG No data
1158436962_1158436975 27 Left 1158436962 18:57440673-57440695 CCTGCTAGGGGCACCGCGTGCGT No data
Right 1158436975 18:57440723-57440745 CCTTGGGTGACACGGGCCGCTGG No data
1158436967_1158436975 -4 Left 1158436967 18:57440704-57440726 CCCGCTGCGCCGGGGACGTCCTT No data
Right 1158436975 18:57440723-57440745 CCTTGGGTGACACGGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158436975 Original CRISPR CCTTGGGTGACACGGGCCGC TGG Intronic