ID: 1158437094

View in Genome Browser
Species Human (GRCh38)
Location 18:57441421-57441443
Sequence ACCGCAGCTCCTCCCCCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158437089_1158437094 12 Left 1158437089 18:57441386-57441408 CCGCTTCGCCAGCTCTGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG 0: 1
1: 0
2: 0
3: 13
4: 184
1158437091_1158437094 4 Left 1158437091 18:57441394-57441416 CCAGCTCTGCGCGGGTTCTCCCG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG 0: 1
1: 0
2: 0
3: 13
4: 184
1158437087_1158437094 21 Left 1158437087 18:57441377-57441399 CCAGCGGTGCCGCTTCGCCAGCT 0: 1
1: 1
2: 1
3: 9
4: 76
Right 1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158437094 Original CRISPR ACCGCAGCTCCTCCCCCGCG AGG Intronic
900082601 1:869845-869867 CGCGAAGCTCCTTCCCCGCGTGG - Intergenic
900095961 1:940237-940259 GCCGGCGCCCCTCCCCCGCGCGG - Intronic
900237371 1:1599207-1599229 CCGGCAGGTCCTCCTCCGCGGGG + Exonic
900395976 1:2453442-2453464 ACCGCAGGCCCTCCCCAGCCTGG + Intronic
900401008 1:2472863-2472885 ACCGCAGCCCCTCCCACGACAGG - Intronic
901300665 1:8197998-8198020 ACCGCATCTCCGCCCCCGTAAGG - Intergenic
901645593 1:10715346-10715368 ACCGCAGATCCTGCCTAGCGCGG - Intronic
904741107 1:32676533-32676555 ACCGCAACTCCTCCGCCTCCTGG - Intronic
904841132 1:33372668-33372690 TCTGCAGCTCCTCCCCAGCACGG + Intronic
906231780 1:44170656-44170678 AGCTCAGCTCCTCCCCCTAGAGG - Intergenic
909707916 1:78608772-78608794 ATCGCAGCTCCTCTCCAGCCAGG + Intergenic
909770488 1:79415245-79415267 AACGCAGCTCCTCACCAGCAGGG + Intergenic
913512586 1:119574972-119574994 ATCGCAGCTCCTCACCAGCAAGG + Intergenic
916721756 1:167489716-167489738 GCCGCAGCTCCTCAGCAGCGGGG - Intronic
916773636 1:167937020-167937042 ACCTCAGCGCCTCCGCCCCGGGG - Intronic
918282770 1:183023015-183023037 ACCCCAGCGACTCCCGCGCGGGG + Intergenic
924560395 1:245153799-245153821 ACGGCATCTCCGCGCCCGCGGGG - Intergenic
1063418027 10:5889586-5889608 ACCGCGGCTTCTCCCACGCGGGG - Exonic
1065024384 10:21526604-21526626 CCCGCCGCGCCTCCCCCGCCTGG + Intergenic
1065636717 10:27742508-27742530 ACGGCCGCCCCTCCCCGGCGGGG + Intronic
1066109367 10:32182647-32182669 ACCCCAGCTGCTGCCCCGGGTGG + Intergenic
1066575497 10:36820150-36820172 GCCTCAGCTGCTTCCCCGCGGGG + Intergenic
1068495454 10:57779944-57779966 ATCGCAGCTCCTCGCCAGCAAGG + Intergenic
1070947892 10:80408457-80408479 CCCGGAGCTCCTCCCACGGGGGG + Intronic
1072654171 10:97319188-97319210 ACAGCACCCCCTCCCCGGCGCGG + Intergenic
1073812376 10:107164740-107164762 AGCTCAGCTCCACCCCCGCGCGG - Intergenic
1075746131 10:124728994-124729016 AGCTCAGCTCCTGCCCAGCGGGG + Intronic
1076805997 10:132858958-132858980 ACCCCGGCTGCACCCCCGCGGGG - Intronic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077107868 11:849761-849783 CCGGCGGCTCCGCCCCCGCGCGG - Intronic
1081528645 11:43943384-43943406 ACCGCCGCTCCTCGCGCGCTCGG + Intronic
1081641903 11:44761666-44761688 CCCGCAGCTCCTTCCCGGCATGG + Intronic
1081682299 11:45016844-45016866 ACCACAGCTCCTCACCAGCAAGG - Intergenic
1082744533 11:56947890-56947912 ACTGCAGCTCCTCACCAGCAAGG - Intergenic
1083665373 11:64271406-64271428 TCCCCAGCTCTTCCCCCGCCTGG - Intronic
1083665463 11:64271754-64271776 GCCACAGCTCCTACCCCGCGGGG - Exonic
1084275740 11:68050130-68050152 CCCGCAGCTCGTCCCCTCCGAGG + Exonic
1085057289 11:73412725-73412747 ACCTCAGCACCTCCCCAGCAGGG - Intronic
1085409154 11:76281413-76281435 ACCACAGCTCCGCTCCCGCCTGG - Intergenic
1086730372 11:90241158-90241180 AACGCAGCTCCTCACCAGCAAGG + Intergenic
1087364098 11:97197745-97197767 ACCACAGCTCCTCACCAGCAAGG - Intergenic
1088155417 11:106797304-106797326 AACGCAGCTCCTCTCCAGCAAGG - Intronic
1088656766 11:112006911-112006933 ATCGCAGCTCCTCACCAGCAAGG + Intronic
1088691248 11:112330633-112330655 ATCGCAGCTCCTCGCCAGCAAGG - Intergenic
1090204737 11:124878019-124878041 TCTGCAGCTCCTCCCCCGCTGGG - Exonic
1090811819 11:130250893-130250915 ACTGCAACTCCTCTCCAGCGAGG + Intronic
1095224959 12:39669084-39669106 AACGCAGCTCCTCACCAGCAAGG - Intronic
1097281142 12:57846113-57846135 CCCGCAACCCCTCCCCCTCGGGG - Intronic
1101466908 12:104958325-104958347 CCCGCCGCCCCGCCCCCGCGCGG + Intronic
1102278342 12:111599339-111599361 TCCGCCGCCCCTCCCCCGCCCGG - Exonic
1103749865 12:123151148-123151170 GCCGCCGCCGCTCCCCCGCGCGG - Intergenic
1104441460 12:128796904-128796926 ACCGCACCTCCACTCCCGCAGGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1109152100 13:58858996-58859018 GCCTCAGCTGCACCCCCGCGGGG - Intergenic
1112580792 13:100674875-100674897 CCCGCAGCTCCCCACGCGCGCGG + Intronic
1113655117 13:112063119-112063141 ACCCCCGCCCCGCCCCCGCGCGG + Intergenic
1114581180 14:23761743-23761765 AACGCAGCTCCTCTCCAGCATGG - Intergenic
1114784838 14:25585092-25585114 ATCGCAGCTCCTCGCCAGCAAGG - Intergenic
1120632289 14:86905572-86905594 GCCTTAGCTGCTCCCCCGCGGGG - Intergenic
1122364545 14:101186828-101186850 ACGGCATCTCCTCCCCAGGGCGG - Intergenic
1125713487 15:41805495-41805517 ACAGCTGCTCCTCTCCCGCTGGG + Intronic
1127426637 15:58864971-58864993 ACGGCAGCGCCTGCCCCGCGTGG - Intergenic
1128582181 15:68818196-68818218 CCCGCCCCTCCTCCCCGGCGCGG - Intronic
1128992508 15:72272556-72272578 CCTGCCGCTCCGCCCCCGCGGGG - Exonic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1132216813 15:100068861-100068883 AACGCAGCTCCTCACCAGCAAGG + Intronic
1134259306 16:12638058-12638080 ACTGCAGCTTCTACCCCCCGGGG + Intergenic
1136531759 16:30874814-30874836 ACGGCAGCTTCTGCCTCGCGAGG + Intronic
1141748948 16:85945569-85945591 GCTGCTGCTCCTCTCCCGCGGGG + Intergenic
1142050083 16:87952055-87952077 ACCCCAGCCCGTCCCCCGAGGGG + Intronic
1142220546 16:88852487-88852509 ATCGCAGCTCCTCGCCAGCAAGG + Intronic
1142265375 16:89061983-89062005 ACCCCTGCTGCTCCCCCACGAGG + Intergenic
1142887077 17:2919583-2919605 AGGGCAGCTGCTCCCCCGCCTGG - Intronic
1143026539 17:3944835-3944857 ACCTCGGCTCCGCCCCCGAGAGG + Intronic
1143648491 17:8248042-8248064 GCCGGAGCTCCGCCCCCGGGAGG + Exonic
1144371894 17:14598864-14598886 ATCGCAGCTCCTCTCCAGCAAGG + Intergenic
1145884257 17:28371659-28371681 ACCGCTGCTCCTCCGGGGCGTGG + Exonic
1146283497 17:31559699-31559721 ACCGCAGCCCCACTCCCGAGTGG - Intergenic
1147156476 17:38546763-38546785 CCCTCTGCTCCTCCCCCGCCAGG + Intronic
1147683992 17:42276234-42276256 CCCGCAGCTCCTACCTCGCTCGG + Exonic
1148716168 17:49717665-49717687 GCCCCAGCTCCTCCCCAGAGTGG - Exonic
1149610513 17:57955279-57955301 ATTGCAGCCCCTCCCCCGCCCGG - Exonic
1151535859 17:74738408-74738430 ACAGCAGCTCCTCCTCTCCGAGG - Intronic
1151591384 17:75047087-75047109 GGCACAGCGCCTCCCCCGCGCGG + Intronic
1151802510 17:76386231-76386253 ACCGCACCAGCTCCCGCGCGTGG - Exonic
1152358120 17:79816272-79816294 ACCGCAGTACCTCCTCCGCAAGG - Intergenic
1155199376 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG + Intronic
1157600348 18:48889606-48889628 ATGGCAGCCCCTCCCCCGGGAGG - Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1158781906 18:60662626-60662648 CTCGCAGCTCCTCCCCTGCTGGG - Intergenic
1158962190 18:62596418-62596440 ACCTCAGCTCCGCTCCCGCGCGG + Intergenic
1160776909 19:860787-860809 ACCCGGGCTCTTCCCCCGCGCGG - Intronic
1161668968 19:5593958-5593980 GCCGCAGCTCCTCGCGCTCGCGG + Exonic
1165229598 19:34378686-34378708 GCCGCAGCTTCTCCCCTGAGGGG - Intronic
1165455315 19:35907448-35907470 TCCGCAGCCCCTCGCCCCCGAGG + Exonic
1167078032 19:47260735-47260757 CCCCCAGCTCCTCCTCCTCGAGG - Exonic
1167668378 19:50836112-50836134 CCCGCAGCCCCGCCCCCACGCGG + Intronic
1167776967 19:51564787-51564809 TCTGCAGCTCATACCCCGCGTGG + Intergenic
1168056988 19:53869500-53869522 CCCGCACCCCCGCCCCCGCGGGG + Exonic
925792912 2:7510850-7510872 AGTGCACCTCCTCCCCCGCAAGG - Intergenic
927904277 2:26846497-26846519 AGCGCAGCACCGCCCGCGCGCGG + Intergenic
929720392 2:44361951-44361973 GCCGCAGCTCGTCCCCTGCCAGG - Exonic
930011456 2:46941154-46941176 GCCGCGGCTCCACCCCCGCGGGG - Exonic
933777392 2:85779282-85779304 ACCCCAGCTCACCCCCAGCGTGG - Intronic
936483615 2:112907605-112907627 ACACCAGCTCCTGCCCAGCGTGG - Intergenic
938934431 2:136116583-136116605 ACGGCACCTCCTCCCCCAAGCGG + Intronic
943716884 2:191161672-191161694 ATCGCAGCTCCTCTCCAGCAAGG + Intergenic
944018711 2:195074802-195074824 ATCGCAGCTCCTCACCAGCAAGG + Intergenic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
947440494 2:230117140-230117162 ATCGCAGCTCCTCGCCAGCAAGG - Intergenic
947784739 2:232806867-232806889 ACCCCAGCTCCTCCCCAACAGGG + Intronic
948049286 2:234967427-234967449 ACCGCAGCTCCACACCCTCTTGG - Intronic
949049796 2:241891404-241891426 ACCGCAGCTCCTCCCTGCGGAGG - Intergenic
1169048776 20:2558982-2559004 CCCGCGGCCACTCCCCCGCGCGG - Intronic
1172846593 20:37933342-37933364 ACCTCACCTCCTCCCCTGAGTGG + Intronic
1172930043 20:38579946-38579968 CCTGCAGCTGCTCCCCCGCCTGG + Intergenic
1175443827 20:59007328-59007350 ATCGCTGCTCCTGCCCCGCCCGG + Intergenic
1176173816 20:63708314-63708336 TCCGGAGCCCCTTCCCCGCGGGG - Intronic
1181326855 22:22056624-22056646 ACCACAGCTCCTCGCCAGCAAGG - Intergenic
1181956361 22:26590136-26590158 GCCGCGGCCCCGCCCCCGCGCGG - Exonic
1183394512 22:37563501-37563523 ACCCTAACTCCTCCCCCTCGTGG - Intronic
1183988792 22:41584339-41584361 GCAGCAGCTCCTCCCCCAGGTGG + Exonic
1184784675 22:46665916-46665938 CCAGCAGCTCCTTCCCCGGGCGG + Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
949260432 3:2098604-2098626 GACGCAGCACCTGCCCCGCGCGG - Intergenic
949579754 3:5376363-5376385 ATCGCAGCTCCTCGCCAGCAAGG - Intergenic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
952316819 3:32238842-32238864 CTCGCACCTCCTGCCCCGCGCGG + Exonic
952827876 3:37539010-37539032 ACTGCTGCTCCTCTCCAGCGGGG - Intronic
958742794 3:98095447-98095469 ACCGCAGCTCCTCACCAGTAAGG - Intergenic
962080902 3:132137839-132137861 AACGCAGCTCCTCACCAGCAAGG + Intronic
966251200 3:177866824-177866846 ACTGCAACTCCTCTCCCGCAAGG + Intergenic
968382367 4:107675-107697 CCTCCTGCTCCTCCCCCGCGCGG + Intergenic
968646685 4:1744601-1744623 GCTGCAGCTTCTCCTCCGCGTGG - Exonic
968882918 4:3310328-3310350 GCCCCAGCTCCTCTCCCGCCCGG - Intronic
968884730 4:3321701-3321723 ACGTCAGCTCCTCCCCCCAGTGG + Intronic
973982006 4:56315050-56315072 ACCGCAGCTCCTCCACCTTGCGG - Exonic
976065673 4:81184592-81184614 ACCACAGCTCCTCACCAGCCAGG + Intronic
981151001 4:141378878-141378900 AACGCAGCTCCTCACCAGCAAGG + Intergenic
984811092 4:183797349-183797371 CCCGCGTCTCCGCCCCCGCGGGG + Intergenic
985537733 5:474151-474173 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537779 5:474354-474376 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537824 5:474557-474579 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537848 5:474654-474676 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537870 5:474755-474777 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537887 5:474825-474847 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
993790136 5:92198499-92198521 AACGCAGCTCCTCACCAGCAAGG - Intergenic
996348610 5:122514641-122514663 AACGCAGCTCCTCACCAGCAAGG - Intergenic
996910756 5:128655008-128655030 ATCACAGCTCCTCCCCAGCAAGG - Intronic
998009540 5:138683710-138683732 AACGCAGCTCCTCACCAGCATGG - Intronic
1001984210 5:176060562-176060584 GCCGCAGCTCCGCGCCTGCGGGG - Intronic
1002233265 5:177783503-177783525 GCCGCAGCTCCGCGCCTGCGGGG + Intronic
1002262713 5:178006278-178006300 GCCGCAGCTCCGCGCCTGCGGGG - Intergenic
1003290441 6:4775582-4775604 CCCGCAGCTCCCCCCACGCCAGG - Intronic
1003763966 6:9214562-9214584 ACTGCAGCTCCTCACCAGCAAGG + Intergenic
1003995923 6:11538598-11538620 ACCCCCGCTCCTGCCCCGCACGG + Intronic
1005608581 6:27500595-27500617 ACCCCAGCTGCTCCCCAGCCTGG + Intergenic
1006558545 6:34889450-34889472 ACAGCAGCTTCTCCACCGCCGGG - Exonic
1006594477 6:35182611-35182633 CCCGCACCTCCTCCCCAGCTCGG + Intergenic
1006902633 6:37512966-37512988 ACCCCAGCTCCCTCCCCGCAAGG + Intergenic
1009320773 6:62286035-62286057 CGCGCTGCTCCTCCTCCGCGCGG + Exonic
1011884731 6:92079391-92079413 ATCGCAGCTCCTCGCCAGCAAGG + Intergenic
1016542293 6:145179053-145179075 ACCGCAACTCCTCGCCAGCAAGG + Intergenic
1016713879 6:147203090-147203112 ACCCGCGCTCCTCCCCGGCGAGG + Intergenic
1020899945 7:13991366-13991388 CCCGAAGCTCCGCCCCCTCGCGG - Intronic
1021519884 7:21528513-21528535 ACCTCAGCTACTCACCCCCGTGG + Intergenic
1023146340 7:37154267-37154289 ATCGCAGCTCCTCTCCAGCAAGG + Intronic
1027964870 7:84992476-84992498 AACGCAGCTCCTCACCAGCAAGG - Intergenic
1029810164 7:103038923-103038945 ATCGCAGCTCCTCGCCAGCAAGG + Intronic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1032108388 7:129054528-129054550 ACAGCAGCTCCTCCCCAAGGAGG + Intronic
1034162218 7:149002154-149002176 ACTGCTGCTCCTCCCCAGAGAGG + Intergenic
1034429367 7:151033619-151033641 ACCGCAGCTCCTCCCTCCTCCGG + Exonic
1034589738 7:152129070-152129092 TCCGCAGCTCCCCCGCCGCCAGG - Intergenic
1035252501 7:157606327-157606349 GCTGTAGCTCCTCCCCAGCGTGG + Intronic
1041004658 8:53486654-53486676 ACTGCAGCCCCTCCCCCCAGGGG - Intergenic
1041919823 8:63168942-63168964 CCCGGAGCTCCACCCTCGCGCGG + Intronic
1042524824 8:69753263-69753285 ACCGCAGCTCCTGCCCCTCTTGG - Intronic
1043844691 8:85150788-85150810 ATCGCAGCTCCTCGCCAGCAAGG + Intergenic
1043884342 8:85581239-85581261 ATCGCAGCTCCTCACCAGCAAGG + Intergenic
1044840701 8:96334343-96334365 ACCACAGCTTCTCCCCAGCTAGG + Exonic
1044862129 8:96533950-96533972 ACCTCAGCTGCCTCCCCGCGGGG - Intronic
1046702741 8:117419145-117419167 ATGGCTGCTCCTCCCCCGAGGGG - Intergenic
1047121432 8:121909033-121909055 ACCGCAACTCCTCTCCAGCAAGG + Intergenic
1049347204 8:142145399-142145421 ACCGCAGCTCCCCGCCCCCATGG - Intergenic
1050652228 9:7787652-7787674 ACTGCAGATCCTCCCCCACAAGG + Intergenic
1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG + Exonic
1056677230 9:88686056-88686078 GCCGCAGCTGCCTCCCCGCGGGG - Intergenic
1056985665 9:91361917-91361939 ACGGCCGCTCCGCCCCCGCCCGG + Intergenic
1057120902 9:92573131-92573153 AACGCAGCTCCTCGCCAGCAAGG - Intronic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1062012690 9:134275507-134275529 ACCCGGGCTCCTCCCCTGCGGGG - Intergenic
1062585568 9:137247904-137247926 ACCGCAACTCCTCCCCTGCCTGG - Intergenic
1186786020 X:12956425-12956447 ACCACAGCTCCTCCCCTGCCGGG + Intergenic
1188003598 X:25002890-25002912 ACCGCAGCTTCTCCCTCCCCCGG - Intergenic
1192004114 X:67191473-67191495 ATCGCAGCTCCTCACCAGCAAGG - Intergenic
1196860845 X:120025907-120025929 ACCTCAGCTGCCTCCCCGCGGGG - Intergenic
1198683445 X:139204772-139204794 CGCGCAGCTTCTCGCCCGCGGGG + Intronic