ID: 1158438721

View in Genome Browser
Species Human (GRCh38)
Location 18:57454448-57454470
Sequence AGCTCTGTGATGTCAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158438714_1158438721 15 Left 1158438714 18:57454410-57454432 CCAAACAGATCCAGTTTGTATCT 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1158438721 18:57454448-57454470 AGCTCTGTGATGTCAGGCAGGGG 0: 1
1: 0
2: 1
3: 38
4: 319
1158438715_1158438721 5 Left 1158438715 18:57454420-57454442 CCAGTTTGTATCTGAGCCACCAT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1158438721 18:57454448-57454470 AGCTCTGTGATGTCAGGCAGGGG 0: 1
1: 0
2: 1
3: 38
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158438721 Original CRISPR AGCTCTGTGATGTCAGGCAG GGG Intronic
900588405 1:3445112-3445134 AGCTCTGTGCTGACTGGGAGGGG - Intergenic
901198755 1:7454844-7454866 CGCTCTGGGATCTCGGGCAGAGG - Intronic
902116815 1:14128082-14128104 AGCTCAGTGAAGTGAGCCAGTGG + Intergenic
902579724 1:17400803-17400825 AGCTCAGTGTGGTCCGGCAGGGG + Intronic
903022509 1:20404079-20404101 AACTCTGTGAAGGCAGGCAGGGG - Intergenic
903255633 1:22097136-22097158 AGCTGTGTGGTGACAGGCAAAGG - Intergenic
903770013 1:25757861-25757883 TACTGTGTGATCTCAGGCAGGGG + Intronic
904744020 1:32700080-32700102 AGCTCTAGGATGTCAAGCATTGG - Intronic
905442347 1:38003743-38003765 AGCTCTGGGCTGGGAGGCAGGGG - Intronic
905520687 1:38597287-38597309 TGCTCAGTGGTGGCAGGCAGTGG + Intergenic
905603312 1:39272909-39272931 CGCTCTTTGATGTCAGACAAAGG + Intronic
905775151 1:40663581-40663603 AGCTCTGTGGGGTCTGTCAGGGG - Intronic
905862215 1:41359483-41359505 AGCTCTGAGCTGTGAGGCAGAGG - Intergenic
907346052 1:53781461-53781483 AGCTCAGTGGTTTCAGCCAGTGG - Intronic
907518587 1:55008671-55008693 GGCCCTGTGATGTCACACAGGGG - Exonic
907598022 1:55737731-55737753 AGCTCTGTGCGGTTAGGAAGAGG - Intergenic
908120684 1:60983478-60983500 AGGTCTGTGAGGAGAGGCAGAGG - Intronic
910205914 1:84748502-84748524 AGCACTGAGATTTCAGGCATTGG - Intergenic
910745678 1:90571686-90571708 ACCTTTGTGATTTCAGGCAAGGG + Intergenic
912430193 1:109624766-109624788 AGGTCTAGGATGTCAGGCACAGG + Intronic
913037181 1:114981106-114981128 GGCTCTGTGAAGACAGGCAGGGG + Intronic
913046562 1:115078283-115078305 AGCTCTGTGAGGGCAGGGACAGG + Intronic
915028370 1:152854584-152854606 AGCTCTGTCATTGTAGGCAGTGG + Intergenic
915296759 1:154926794-154926816 AGCTCTGAGAGGGCAGGCACAGG - Intronic
916127839 1:161587312-161587334 AGATCTGTGACTTCATGCAGGGG - Intronic
916137756 1:161669116-161669138 AGATCTGTGACTTCATGCAGGGG - Intronic
916196339 1:162226857-162226879 AGCTCTTTGATGACAGGCCTTGG + Intronic
919320457 1:196030403-196030425 ACCTCATTGATGTGAGGCAGTGG - Intergenic
919510154 1:198452723-198452745 AGCTATGTGATGTCATTGAGTGG + Intergenic
919911905 1:202116515-202116537 AGCCCTGTGATTTCAGGAATAGG - Intergenic
921550719 1:216532348-216532370 AGCTCTGGGATACCAAGCAGCGG - Intronic
921832636 1:219745248-219745270 ACCTCGGTGATGTCTGGGAGTGG - Intronic
921844063 1:219860433-219860455 AGCTCAGTGTTGTGAGACAGAGG - Intronic
923243337 1:232107121-232107143 AGCTCTGTGACTTTAGGCAAGGG + Intergenic
1064265288 10:13820859-13820881 AGCTGTGGGATGGCAGACAGGGG + Intronic
1067278509 10:44854348-44854370 GGCACTGTGATAGCAGGCAGGGG + Intergenic
1067385501 10:45814676-45814698 AGATCTTTCATGTCAGGAAGGGG - Intergenic
1067449647 10:46374306-46374328 AGATCTTTCATGTCAGGAAGGGG + Intergenic
1067587729 10:47486455-47486477 AGATCTTTCATGTCAGGAAGGGG - Intergenic
1067634849 10:47994559-47994581 AGATCTTTCATGTCAGGAAGGGG - Intergenic
1068608889 10:59036857-59036879 AGCTCAGAGAAGTCAGGCAAAGG - Intergenic
1068679373 10:59803229-59803251 TGCTCTCTGGTGTCAGGCAGGGG - Intronic
1071478760 10:86046977-86046999 AGCTCTCTCTAGTCAGGCAGTGG + Intronic
1071610266 10:87025475-87025497 AGATCTTTCATGTCAGGAAGGGG + Intergenic
1072407181 10:95166417-95166439 AGTTCTGTGAAGAAAGGCAGTGG - Intergenic
1073199968 10:101727325-101727347 AGCTCTATGGTCTCAGCCAGGGG - Intergenic
1075091206 10:119445026-119445048 AGCTCTGTGATGTGAGGATGAGG - Intronic
1076407291 10:130221022-130221044 AGCTCTGTGATGACACAGAGGGG + Intergenic
1076619631 10:131778957-131778979 CTCTCTGTGGGGTCAGGCAGGGG - Intergenic
1076816070 10:132915296-132915318 AGCCCCGTCATTTCAGGCAGGGG - Intronic
1077010707 11:377992-378014 TGCACAGTGATGACAGGCAGAGG + Intronic
1077863680 11:6205501-6205523 ACCTCTATGATGTCATGCAGTGG + Intergenic
1078011906 11:7578912-7578934 AGCACAGTGATGGCAGACAGAGG + Intronic
1078613894 11:12847055-12847077 AGCACTGTGTTGGCAGGCACTGG - Intronic
1078927127 11:15885090-15885112 TGCTCTGTGTCGTCAGGCGGAGG + Intergenic
1081081195 11:38741270-38741292 AGTTCTGTGAAGAAAGGCAGTGG + Intergenic
1081607192 11:44534889-44534911 AGCTCTCTGAAGTCAGCCTGCGG + Intergenic
1082962138 11:58928485-58928507 AGCTGTGTGAGGACAGTCAGGGG - Intronic
1083041254 11:59689437-59689459 AGCTGAGTGATGTCAGCAAGAGG - Intergenic
1083879105 11:65539602-65539624 CGCTCTGCGATGTCGGGCAATGG + Exonic
1084189290 11:67491736-67491758 TGCCCTGTGATGCCAGGCATGGG + Intergenic
1084567000 11:69935586-69935608 AGGTCTGTGATCTAAGGAAGGGG - Intergenic
1084608231 11:70184972-70184994 AGCACTGTAATCTCAGGCTGAGG - Intronic
1085253997 11:75162085-75162107 AGCTCTGTGATGACATGCACAGG + Intronic
1085440860 11:76561220-76561242 AACCCTGTGATGTCAGGAATTGG - Intergenic
1087676689 11:101170868-101170890 ATCTCTGTGATGGCAGAGAGAGG + Intergenic
1089428348 11:118399930-118399952 AGCTCTGGGATTACAGGCACAGG - Intronic
1089922137 11:122219337-122219359 AGCTGTGAGATGCCAGGCACGGG + Intergenic
1090381966 11:126333691-126333713 AGCACTGAGATGGTAGGCAGGGG + Intronic
1090462637 11:126905740-126905762 GGCTCTGTGTTGTCAGGCTGTGG - Intronic
1090465812 11:126932097-126932119 TGCTCTGGGAGGTCAGGCAGAGG - Intronic
1090776314 11:129968932-129968954 AGCTCTGTGCTGCCTGGCAGTGG + Intronic
1093262975 12:16963956-16963978 AGTTCTGTGATGAAAGTCAGTGG + Intergenic
1093688487 12:22083364-22083386 AGATCTGTGATGACACCCAGTGG - Intronic
1093766459 12:22968904-22968926 AGCTCTGTCATAGCTGGCAGTGG - Intergenic
1095733747 12:45534522-45534544 AACTCTGTGACCTCAGGCAAAGG + Intergenic
1097198438 12:57258016-57258038 AACTGTGTGAGGACAGGCAGGGG + Exonic
1097863035 12:64536878-64536900 AACTCTGTTCTGCCAGGCAGTGG - Intergenic
1098013936 12:66084536-66084558 TGTTCTGTGATTTAAGGCAGTGG + Intergenic
1098346644 12:69512022-69512044 AGCTCTGTGGAGTCTGGCAAAGG - Intronic
1099363706 12:81741746-81741768 TGCTCTCTGAGGTCAGGCAGGGG - Intronic
1101524033 12:105511387-105511409 AGCACTGTGAAGCCAGGCTGTGG + Intergenic
1101575386 12:105992524-105992546 AGGTGTGTGATGTCAGCAAGAGG - Intergenic
1101855400 12:108438289-108438311 AGCTCTGTGAGGTCAGGGGAGGG - Intergenic
1101898797 12:108775777-108775799 AGCTCTCGGGTGCCAGGCAGGGG - Intergenic
1102545038 12:113648339-113648361 ATCTCTGAGATGTCAGGCTAAGG - Intergenic
1102998745 12:117369046-117369068 AGCTCTAGGCTGTCAGGCTGTGG - Intronic
1103128521 12:118446182-118446204 GGGTATGTGATGACAGGCAGGGG + Intergenic
1103413138 12:120726638-120726660 AGCTCTGTGACCTTAGGCAAGGG - Intronic
1103744737 12:123114851-123114873 AGCTCAGTGAGGTGAAGCAGCGG - Intronic
1104480236 12:129101164-129101186 AGCTCTGTGGTGCCAGTCGGTGG + Intronic
1104725272 12:131071773-131071795 AGTTCAGTGCTGTCAGCCAGAGG - Intronic
1104801762 12:131559379-131559401 AGTTCAGTGCTGTCAGCCAGAGG + Intergenic
1106930029 13:34653566-34653588 GGCTGTGTGATCCCAGGCAGAGG - Intergenic
1107335317 13:39348473-39348495 AGCCCTGTGAGTTCAGGCTGAGG + Intronic
1110469815 13:75846719-75846741 AGCTCTTGGATAGCAGGCAGTGG + Intronic
1111897644 13:94161004-94161026 AGCTCTGTGGGGGCAGGCACTGG - Intronic
1114659626 14:24335923-24335945 AGCTCTGCTATGGCAGGAAGTGG - Intronic
1116112140 14:40599268-40599290 AGTTCTGTGATGTCAGGTTCAGG + Intergenic
1117813924 14:59577683-59577705 AGCTCTGTGATGACGGGGACAGG + Intergenic
1117880493 14:60308748-60308770 AACTATGTTATGTGAGGCAGGGG - Intergenic
1118322191 14:64759688-64759710 ACCTTTGTGCTGTAAGGCAGGGG + Intronic
1118454466 14:65931993-65932015 AGCTCTGGGAAGTCAGCCAGTGG + Intergenic
1119427396 14:74544598-74544620 AGCTCTGTGATGCCAGCCCCTGG - Intronic
1119558536 14:75571665-75571687 GGCTCTGTGAGGTGTGGCAGTGG + Intergenic
1120637706 14:86972551-86972573 AGCTATTTGAAGTCAAGCAGAGG + Intergenic
1121195451 14:92067866-92067888 AGGCCTGTGATGTCAAGGAGTGG + Intronic
1122780841 14:104142781-104142803 AGCTCTGCCAGGTCAGGCATGGG + Intronic
1122871627 14:104641389-104641411 AGCTGTGGGATGCCAGGGAGGGG - Intergenic
1125759218 15:42085525-42085547 TGCTCTCTGATTTCAGGGAGAGG - Exonic
1125834767 15:42739258-42739280 ATCTCTCTGATTTCAGGAAGAGG + Exonic
1127111831 15:55682446-55682468 AGATCTATGATGTCAGCCAAAGG - Exonic
1127399850 15:58574673-58574695 AGCTTGGTGAAGTCAGGGAGAGG + Intergenic
1128235027 15:66061240-66061262 TGCTCTGTGAAGTCAGGGTGGGG - Intronic
1128534290 15:68479062-68479084 AGCTCTGAGATGGCAGGCATTGG + Intergenic
1128730729 15:70019125-70019147 AGCTCTGTGATCTTAGGCACTGG + Intergenic
1128978482 15:72169715-72169737 AGGTCTGTGAGGTCAGGCACAGG - Intronic
1131268331 15:90931965-90931987 AGCCCTGAGATGTCAGCCAAGGG + Intronic
1132166363 15:99595466-99595488 AGCTCTATGAAGTCAGGAATAGG + Intronic
1133707330 16:8367303-8367325 AGCTCCATGAGGGCAGGCAGTGG - Intergenic
1134846236 16:17443066-17443088 AACTCTGTGACCTCAGGCAAGGG + Intronic
1135235029 16:20747199-20747221 TGCTCTGGGATGGCAGGGAGAGG - Intronic
1135733454 16:24913045-24913067 AGCTCTGTCAGGCCAGGAAGGGG - Intergenic
1136122831 16:28150954-28150976 AGCTCAGAGGTGTCAGGTAGAGG - Intronic
1136397699 16:30002028-30002050 AGCTCTGTGAGGGCAGGCACTGG - Intronic
1137759377 16:50928047-50928069 ATCTATGTGATGTCAGGGAGAGG + Intergenic
1140410188 16:74736555-74736577 GTCTGTGTTATGTCAGGCAGGGG + Intronic
1140958730 16:79892361-79892383 AGCCCTGTGACTTCAGGCAAGGG - Intergenic
1141359707 16:83384305-83384327 GGCTCTGGGAAGTCAGGCAGAGG - Intronic
1142000647 16:87662394-87662416 AGCCTAGTGAAGTCAGGCAGAGG - Intronic
1142064945 16:88056677-88056699 GACTCTGTGATGTCAGACAGTGG + Intronic
1142101935 16:88276555-88276577 ACCCCTGTGATGCCTGGCAGTGG - Intergenic
1142176430 16:88647554-88647576 GGCTCTGTGACCTCAGGCAGTGG - Intronic
1142979606 17:3663980-3664002 AGCCCTGGGATGTTAGGCTGGGG - Intronic
1142983001 17:3682130-3682152 AGCTCTGTGGTGTCGGACAAGGG - Intronic
1147215749 17:38898053-38898075 AGCTCTGTGACCTTGGGCAGGGG + Intronic
1147337915 17:39738277-39738299 CGCTCGGTGATGTCAGGCCAGGG + Intronic
1149000431 17:51751964-51751986 AGCTCCATGATGGCAGGGAGAGG - Intronic
1149612494 17:57967760-57967782 AGCTCTGGGATTTCAGGAAAGGG + Intergenic
1149810447 17:59664889-59664911 ACCTGTGTGATGTCAGCAAGAGG - Exonic
1149949725 17:60972714-60972736 AGCTCTGAGATTGCAGGCATGGG + Intronic
1150125690 17:62633023-62633045 AGCTATGTGACCTCAGGCAGAGG + Intronic
1150942892 17:69712586-69712608 AGCTCTCTGCTGTCAGACAGCGG - Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1151539977 17:74759848-74759870 GGCTGTGTGATGTCAGGCAGTGG + Intronic
1151830290 17:76545287-76545309 AGCCCTGTGATGGGAGCCAGTGG - Intronic
1152253304 17:79222966-79222988 AGCTCTGGGGTGTCAGGGTGTGG + Intronic
1152657946 17:81528594-81528616 AGCTCTCAGCTGTCAGGTAGCGG - Exonic
1153945476 18:10013773-10013795 ACCGCTGTGATAGCAGGCAGTGG + Intergenic
1155645330 18:28070679-28070701 AGCTCTGTGAGGGCTGGGAGTGG - Intronic
1157866146 18:51186541-51186563 AAGTCTCTGATGTCAGGCAAGGG + Intronic
1158438721 18:57454448-57454470 AGCTCTGTGATGTCAGGCAGGGG + Intronic
1160049731 18:75421582-75421604 AGCTCTGTGGGGTCAGGGTGGGG + Intronic
1163131237 19:15274539-15274561 AGGTAAGTGATGGCAGGCAGGGG + Intronic
1163506344 19:17709302-17709324 ATCTCTGTGATGTCAGGGCTGGG - Intergenic
1163775618 19:19215582-19215604 AGCTGTGTGAAGTCAGGAGGAGG + Intronic
1163798820 19:19352921-19352943 AGTCCTGTGAGGTCAGGCTGGGG + Intronic
1165312704 19:35038529-35038551 AGCTGTGTGACCTCAGGCAAAGG - Intronic
1167128878 19:47571534-47571556 ATCTAAGTGATGCCAGGCAGTGG - Intergenic
1167168908 19:47818083-47818105 AGCACTGTGAGGTCAGACTGTGG - Intronic
1167356119 19:49005334-49005356 AGCTCTTTGAAGTCAGGCCTTGG - Intronic
1168241395 19:55090891-55090913 AGCTCTGTGTTCCCAGCCAGAGG - Exonic
925647767 2:6054581-6054603 AGCTCCATGATGTACGGCAGAGG + Intergenic
926272754 2:11378925-11378947 AGCTCTGGGAAGGGAGGCAGGGG + Intergenic
927149623 2:20188191-20188213 GGCACTGTGCTGTCTGGCAGCGG - Intergenic
928403793 2:30998714-30998736 AGCTGTGTGATATCAGACACAGG - Intronic
933421958 2:82059737-82059759 AGTCCTGGGATTTCAGGCAGAGG + Intergenic
933866479 2:86522832-86522854 AGTTCTGAGATATCAGGCTGAGG - Intronic
934784744 2:96996766-96996788 ACCTCTTTGAAATCAGGCAGTGG - Intronic
935147458 2:100405543-100405565 AGCTCTGTGAGGTGGAGCAGGGG + Intronic
935307505 2:101751601-101751623 TGCTCCATGAGGTCAGGCAGAGG - Intronic
936191525 2:110338765-110338787 AGGTCTGTGATGCGAGGTAGAGG + Intergenic
937066080 2:119019032-119019054 AGGTGTGTGTTGTCAGGCCGGGG + Intergenic
937073296 2:119082289-119082311 AGGACAGTGATGTCAGGGAGAGG + Intergenic
937116400 2:119407863-119407885 TTGTCTGTAATGTCAGGCAGAGG + Intergenic
937703223 2:124887802-124887824 GGCCCTGTAAAGTCAGGCAGTGG + Intronic
940567453 2:155385799-155385821 AGCTCTATGAGGTCAGGAGGTGG - Intergenic
941004925 2:160238189-160238211 AGGCATGTTATGTCAGGCAGAGG - Intronic
941758612 2:169216171-169216193 TGTTCTGAGCTGTCAGGCAGTGG - Intronic
941850853 2:170178418-170178440 ATCTGGGTGATGTCAGACAGAGG - Intronic
942497914 2:176559004-176559026 TTCTCTGTGTGGTCAGGCAGGGG + Intergenic
944218440 2:197278598-197278620 AGTTCTGGGATTTCAGGCATGGG + Intronic
945180947 2:207090551-207090573 ACCTCTGTGAACACAGGCAGAGG - Intronic
945472163 2:210239586-210239608 ATCTCTCTCATTTCAGGCAGAGG - Intergenic
946108816 2:217396199-217396221 AGCTGGGTCAGGTCAGGCAGTGG + Intronic
947349187 2:229224994-229225016 GTCTCTGAAATGTCAGGCAGGGG + Intronic
947809922 2:232997858-232997880 CGCTCGGTGACGCCAGGCAGAGG - Intronic
948161896 2:235831484-235831506 AGATCTGTGATTTCAGGCGGTGG - Intronic
948231680 2:236353687-236353709 AGCTCTGTGGTGGGAAGCAGGGG + Intronic
948281979 2:236753722-236753744 ACCTCTGAGCTGTGAGGCAGAGG + Intergenic
948316069 2:237029334-237029356 ATCTCTGGGCTGCCAGGCAGTGG - Intergenic
1169566598 20:6860250-6860272 AACTTAGAGATGTCAGGCAGTGG + Intergenic
1170299460 20:14866990-14867012 AGCTCTGAAATTACAGGCAGGGG - Intronic
1171203207 20:23258073-23258095 TGCACTGCGATGCCAGGCAGGGG - Intergenic
1171388618 20:24786800-24786822 AGCTCTGTGGGGTCAGTCAGGGG - Intergenic
1172449294 20:35010455-35010477 AACTCTGGGCTCTCAGGCAGTGG + Intronic
1173646735 20:44637961-44637983 AGCTGTGTGACCTCAGGCAAGGG + Intronic
1173933723 20:46843470-46843492 AGCTCTGTGATGAGGGGCTGAGG + Intergenic
1174176511 20:48648793-48648815 AGCTCTAGGATGTGGGGCAGAGG - Intronic
1175125563 20:56748869-56748891 AGATCTGTGTTGTCTGGAAGTGG + Intergenic
1175641713 20:60635810-60635832 AGCTCAGCTGTGTCAGGCAGGGG - Intergenic
1175913959 20:62417076-62417098 GGCTCTGAGATGTCCTGCAGTGG + Intronic
1176181565 20:63752004-63752026 AGCTGTGTGAGGAGAGGCAGTGG - Intronic
1178226330 21:30723617-30723639 AGATCTGTGAGCCCAGGCAGAGG - Intergenic
1178360621 21:31946404-31946426 AGCTCTGTGAGGGCAGGACGTGG - Intronic
1178521642 21:33292192-33292214 AGCTGTGGGATCCCAGGCAGGGG - Intronic
1178592223 21:33920992-33921014 ATCACTGTGATGTCAGGCCAGGG + Intergenic
1178666670 21:34553430-34553452 AGCTGTGTGCTATCAGGAAGTGG - Intronic
1180722428 22:17919586-17919608 AACTGTGTGCTTTCAGGCAGTGG + Intronic
1181890007 22:26054146-26054168 TGCTCTGTGATGCTAAGCAGTGG - Intergenic
1182046739 22:27280498-27280520 AGCTGTGTGACTTCAGGCAGAGG - Intergenic
1183044239 22:35207092-35207114 AGCTGTGTGAAGTCAGGCGAGGG - Intergenic
1183738609 22:39657606-39657628 AGCTCTGTGGCCTCAGGCAAGGG + Intronic
1184108043 22:42379821-42379843 AGGTCTGTGATGGTGGGCAGGGG - Intergenic
1185347034 22:50314938-50314960 AGGTCGGGGAGGTCAGGCAGGGG + Intronic
951864658 3:27294644-27294666 GTCTCTGTGCTGGCAGGCAGGGG - Intronic
953078014 3:39588507-39588529 AGCTCTTTGATGTCAGTTGGTGG - Intergenic
953535375 3:43773329-43773351 AGCTATGGCATGACAGGCAGTGG + Intergenic
953548228 3:43880376-43880398 AGCTGTGAAATGTGAGGCAGGGG - Intergenic
953869737 3:46615882-46615904 TGCTCTGGGGTGTCAGGCACTGG + Intronic
954427707 3:50452111-50452133 ACCTCTGTGACCACAGGCAGTGG - Intronic
954841352 3:53514612-53514634 AGCACTGTGCTGTGAGCCAGAGG + Intronic
959113584 3:102149809-102149831 AGCTCTAATATGTCTGGCAGCGG + Intronic
959658817 3:108842434-108842456 AAGTCTGTGATGTCAGGGAAGGG - Intronic
960987225 3:123288834-123288856 ACCTCTGTGGTGTCCGGCAGAGG - Intronic
961448645 3:126992548-126992570 GGCTCTGTGATCTCTGGGAGGGG + Intronic
961477410 3:127157422-127157444 ACCTGTGGGGTGTCAGGCAGGGG + Intergenic
961682268 3:128607377-128607399 ATCTCCCTGATGTCAGGGAGGGG + Intergenic
962239781 3:133742669-133742691 AAGTCTCTGGTGTCAGGCAGAGG + Intergenic
962420557 3:135225346-135225368 AGCTCTGTGACATCTGTCAGTGG - Intronic
962893869 3:139697086-139697108 AACTCTGTGGTGCCAGGCAAGGG - Intergenic
966769905 3:183494417-183494439 AGGTGTGTGATGTCTGGCAGGGG + Intronic
967074327 3:185988655-185988677 AGGTCCCTGATGGCAGGCAGGGG - Intergenic
967599935 3:191374640-191374662 AGCTTTGTAATTTCAGACAGAGG - Intronic
968030504 3:195481549-195481571 ACCACTGTGATGTCACACAGAGG - Intergenic
968030607 3:195483579-195483601 ACCACTGTGATATCAGACAGAGG - Intergenic
968030784 3:195486820-195486842 AGCACTGTGATATCATACAGAGG - Intergenic
968030872 3:195488516-195488538 ACCACTGTGATGTCACACAGAGG - Intergenic
968031077 3:195492213-195492235 ACCACTGTGATGTCACACAGAGG - Intergenic
968031237 3:195495379-195495401 ACCACTGTGATGTCATACAGAGG - Intergenic
968031240 3:195495417-195495439 ACCACTGTGATATCATGCAGAGG - Intergenic
968031243 3:195495455-195495477 ACCACTGTGATGTCATACAGAGG - Intergenic
968031302 3:195496401-195496423 ACCACTGTGATGTCACACAGAGG - Intergenic
968031312 3:195496553-195496575 ACCTCTGTGATATCATACAGAGG - Intergenic
968031498 3:195500059-195500081 ACCTCTGTGATATCATACAGGGG - Intergenic
968031629 3:195502248-195502270 ACCACTGTGATGTCACACAGAGG - Intergenic
968031813 3:195505794-195505816 ACCACTGTGATGTCACACAGAGG - Intergenic
968031829 3:195505984-195506006 ACCACTGTGATGTCACACAGAGG - Intergenic
968031866 3:195506586-195506608 AGCACTGTGATATCATACAGAGG - Intergenic
968031875 3:195506738-195506760 ACCACTGTGATATCAGACAGAGG - Intergenic
968031895 3:195507039-195507061 ACCACTGTGATGTCATACAGAGG - Intergenic
969364517 4:6686357-6686379 AGCCCTGTGCTCACAGGCAGGGG + Intergenic
970236077 4:13959346-13959368 GGCTGTCTGATGCCAGGCAGAGG + Intergenic
970338776 4:15082778-15082800 AGCTTTGTGATCTGGGGCAGAGG - Intergenic
970745174 4:19285659-19285681 AGCTTTATGCTGTCATGCAGAGG - Intergenic
972152406 4:36110074-36110096 AGCCATGTGATGTGAGGCAAGGG - Intronic
973876079 4:55220500-55220522 TGCACTGTGAAGCCAGGCAGTGG - Intergenic
975221628 4:71819075-71819097 GGCTCTGTGATGTCAGGGTCTGG + Intergenic
980483354 4:133419381-133419403 ACCTCTGTGGTGACAGACAGTGG - Intergenic
983972859 4:173895621-173895643 GGCTCCGTGATGTCATGAAGAGG - Intergenic
985577884 5:682156-682178 AGCTCTGTGATCAGAGGCTGGGG - Intronic
985592817 5:774300-774322 AGCTCTGTGATCAGAGGCTGGGG - Intergenic
985658248 5:1143025-1143047 AGCTCTGTGGTGCCCGGCACGGG - Intergenic
985694066 5:1330122-1330144 AGCTGTAGGATGGCAGGCAGTGG - Intronic
985821865 5:2166086-2166108 GGCTATGTGGGGTCAGGCAGAGG + Intergenic
987759405 5:22140942-22140964 AGCTTTGTGATTTCAGGCTGAGG - Intronic
989598475 5:43180057-43180079 AGTGCTGAGATGACAGGCAGGGG + Intronic
991894127 5:71374372-71374394 AGCTTTGTGATTTCAGGCTGAGG - Intergenic
992327442 5:75674904-75674926 AACTCTGTGGTGTCTGGAAGAGG + Intronic
997435984 5:133875979-133876001 AGCTGTGTGTTCTCAGGCAAGGG + Intergenic
997836382 5:137196505-137196527 TACTCTGTGATGGAAGGCAGTGG - Intronic
999148875 5:149413575-149413597 AACTCTGAGATGTCAGGCAATGG + Intergenic
999293042 5:150440120-150440142 AGCTCTGAGAGGGCAGGGAGTGG + Intergenic
999674587 5:153986446-153986468 TGCTCTGTGAGGCCAGGCAATGG - Intergenic
1000062278 5:157668288-157668310 AGCTCCAGGCTGTCAGGCAGGGG + Intronic
1000963886 5:167631919-167631941 AGCACTGTGAGGTCAGGAATTGG + Intronic
1001032552 5:168273226-168273248 GGCTCTGTGATGGCTGGCACAGG - Intergenic
1001163622 5:169343607-169343629 AGCTGTGGAATGTCAGCCAGGGG + Intergenic
1001936463 5:175709203-175709225 AGGTCGGGGATGTCAGGGAGGGG - Intergenic
1002101188 5:176858477-176858499 GGCTCAGTGATGTCAGTCAAAGG + Intronic
1002336084 5:178479264-178479286 AGCTGTGTGATTTGGGGCAGGGG - Intronic
1002457075 5:179351290-179351312 TGCTCCGTCATGTCAGGGAGGGG - Intergenic
1003792123 6:9557817-9557839 AGCTGTGTTATTTCAGGTAGGGG - Intergenic
1005140983 6:22631218-22631240 AGATCTGTGCTGGCTGGCAGTGG - Intergenic
1005598478 6:27402491-27402513 AGCTCTGTGATTTGGGGCAAGGG + Exonic
1005993446 6:30917707-30917729 AGCTGTGTGTGGCCAGGCAGGGG - Exonic
1007398444 6:41590252-41590274 AGCTCTGGGGAGACAGGCAGAGG - Exonic
1007719236 6:43875624-43875646 AGCTCTGTGAGGTCTGGCCGGGG - Intergenic
1013185775 6:107756847-107756869 AGTTCTGTGCTGCCAGGAAGAGG - Intronic
1015310982 6:131767135-131767157 TCCTCTGTGATGTCAGGGAGCGG + Intergenic
1015957641 6:138614997-138615019 AGCTTTGTGATCTAGGGCAGTGG - Intronic
1016053714 6:139556555-139556577 ATCTCTCTGCTGTCTGGCAGGGG + Intergenic
1018049417 6:159996374-159996396 AGCTCTGTTGCTTCAGGCAGTGG + Intronic
1020081558 7:5288739-5288761 AGCTGTGTGACGTTAGGCAAGGG + Intronic
1021669949 7:23025439-23025461 AGTTCTGTGATGTTAGGAGGAGG + Intergenic
1022049016 7:26646898-26646920 TGCTCTGTAATCACAGGCAGTGG + Exonic
1022178077 7:27891560-27891582 AACTCTGTGATTACAGGCAGGGG - Intronic
1022407385 7:30103734-30103756 ACCTGTGTGATGTGAGGTAGGGG - Intronic
1023165003 7:37335047-37335069 AGCTCTTGGAGGTCAGCCAGTGG - Intronic
1023760713 7:43462742-43462764 AGCTCTGAGATGCCTGGCAGCGG - Intronic
1023866771 7:44242107-44242129 AGCTCTTGGATGTCAGGAACAGG + Intronic
1024585041 7:50834846-50834868 TGCTCAGTGATGTCTGGCATGGG + Intergenic
1025067114 7:55866608-55866630 ATCTTTGTAATGTCAGGCATTGG - Intergenic
1025282632 7:57639160-57639182 GGCCCTGTGATGTCATGCCGAGG - Intergenic
1027780604 7:82515362-82515384 AGCACTGTGATTTTAGGCAATGG + Intergenic
1029727309 7:102415674-102415696 AGCCCTGTGAGGTTAGTCAGTGG + Intronic
1030886543 7:114945273-114945295 AGCTCTGGAAAGTCAGGGAGTGG + Intronic
1031535234 7:122925881-122925903 AGCTGTGTGATTTCAGGGTGTGG + Intergenic
1031957226 7:127954889-127954911 AGATCTGTGATTTCTGGAAGTGG - Intronic
1031977912 7:128105414-128105436 AGCTTTGGGATGGCAGGCAGAGG + Intergenic
1032056317 7:128687438-128687460 AGCTCTGTGAATTCAGATAGGGG + Intergenic
1032217278 7:129967404-129967426 AGCTCTGTATTGTCAAGCAGGGG + Intergenic
1033594939 7:142852147-142852169 AGCCCTGTGAGGTCATGCATTGG + Intergenic
1033888674 7:145980277-145980299 AGCCTTGGAATGTCAGGCAGTGG - Intergenic
1034276753 7:149827202-149827224 AGGGCTGTGATGCCAGGAAGTGG + Intergenic
1036152452 8:6311234-6311256 AGATTTGTGATATCAGGCATTGG - Intergenic
1039656766 8:39418250-39418272 ATTTCTGTGATGTGAGGGAGAGG - Intergenic
1039962754 8:42262379-42262401 ATCTGTGTGATGTCAGTCAGGGG - Intergenic
1040101666 8:43511804-43511826 CGCTGTGTGACCTCAGGCAGGGG + Intergenic
1040418377 8:47217008-47217030 TGCTCTGGGATGTTAGGCATTGG - Intergenic
1040558718 8:48504654-48504676 TGCTCTGTGGTGACAGCCAGAGG - Intergenic
1044928966 8:97233790-97233812 AGCTCTGTGACATCTGGAAGGGG - Intergenic
1045781437 8:105868257-105868279 AGCTCTTTGAGGTCAGGAACTGG - Intergenic
1046031109 8:108785036-108785058 ACCTCTGTGATGCCAGGGACTGG - Exonic
1046278577 8:111994035-111994057 AGCCCTGTGATGTGTAGCAGAGG - Intergenic
1047959578 8:130001217-130001239 TGCTCTGTGGTGGGAGGCAGGGG - Intronic
1048949530 8:139483857-139483879 ACCTCTGTGATGTCCTTCAGTGG + Intergenic
1049542965 8:143216685-143216707 AGCTCTGGGACAGCAGGCAGAGG + Intergenic
1051592649 9:18792039-18792061 ACCTGTCTGATTTCAGGCAGAGG - Intronic
1052347884 9:27428307-27428329 AGCAATATGATCTCAGGCAGAGG + Intronic
1053440075 9:38108827-38108849 AGCTCTGAGATCTGAGGAAGGGG + Intergenic
1057535333 9:95897203-95897225 TGCTCTGTGAAGTTAGGCAAGGG - Intronic
1057779038 9:98034954-98034976 AGCTCTGTCCTTTCACGCAGAGG - Intergenic
1060794393 9:126504371-126504393 CACTCTGTGGTGTCAGGCACTGG + Exonic
1061059790 9:128244670-128244692 GGTTCTGGGATGGCAGGCAGGGG + Intronic
1061360091 9:130135927-130135949 TGCTCTGGGCTGTCAGGGAGTGG - Exonic
1061789743 9:133052666-133052688 TGCTCTGTGAGGCCTGGCAGCGG - Intronic
1062340629 9:136092487-136092509 AGCCCTGTGGTGTGAGGCCGTGG - Intronic
1062622962 9:137430865-137430887 AGCTGGGTGAGGCCAGGCAGGGG - Intronic
1186217429 X:7314862-7314884 GGCTCTGTGAGGGCAGGGAGTGG + Intronic
1186803142 X:13113545-13113567 GGCTCTGAGATGCCAGGCAATGG + Intergenic
1189303210 X:39967745-39967767 AGCTCTGCGAGGCCAGGCACGGG + Intergenic
1189593583 X:42541279-42541301 AGCTCTCGGATCTCAGTCAGTGG + Intergenic
1189996502 X:46644170-46644192 GGCTATGTGAAGACAGGCAGTGG + Intronic
1191975181 X:66863777-66863799 AGCTGTGTGATCTTAGGCATTGG - Intergenic
1192367499 X:70486328-70486350 AGCACTGTGACTTCAGGCTGGGG + Intronic
1195345267 X:103944100-103944122 TGCCCAGTGATGTCAGGTAGAGG - Intronic
1195849606 X:109268928-109268950 GGCTATGTGATCTCAGGCAAAGG + Intergenic
1195877844 X:109561065-109561087 AGATATATGCTGTCAGGCAGAGG + Intergenic
1197760520 X:130024777-130024799 AGCCCTGTGAGGTCAGTAAGGGG + Intronic
1198671393 X:139084514-139084536 AGCTCTGTGATCTGGGTCAGTGG + Intronic
1200183924 X:154169586-154169608 CGCTTTGTGATGGCAGCCAGAGG - Intergenic
1200189578 X:154206714-154206736 CGCTTTGTGATGGCAGCCAGAGG - Intergenic
1200195331 X:154244523-154244545 CGCTTTGTGATGGCAGCCAGAGG - Intergenic
1200200983 X:154281644-154281666 CGCTTTGTGATGGCAGCCAGAGG - Intronic
1200361698 X:155613152-155613174 AGCACTGAAATGGCAGGCAGGGG - Intronic
1200766636 Y:7085764-7085786 TGCTCTTTGATGTCAGGCTGAGG + Intronic
1201313715 Y:12621806-12621828 AGCTCCGTTACCTCAGGCAGTGG - Intergenic
1201985206 Y:19958080-19958102 AGCTCTCTGCTGACAGACAGGGG + Intergenic