ID: 1158440485

View in Genome Browser
Species Human (GRCh38)
Location 18:57470641-57470663
Sequence GCAGTGGTGTTAGCTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158440485_1158440494 18 Left 1158440485 18:57470641-57470663 CCTTGAAGAGCTAACACCACTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1158440494 18:57470682-57470704 CAAGGTGACATGCGGTTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1158440485_1158440487 -9 Left 1158440485 18:57470641-57470663 CCTTGAAGAGCTAACACCACTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1158440487 18:57470655-57470677 CACCACTGCACCTGCGGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 119
1158440485_1158440492 10 Left 1158440485 18:57470641-57470663 CCTTGAAGAGCTAACACCACTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1158440492 18:57470674-57470696 CTGGGTGTCAAGGTGACATGCGG 0: 1
1: 0
2: 4
3: 15
4: 242
1158440485_1158440490 0 Left 1158440485 18:57470641-57470663 CCTTGAAGAGCTAACACCACTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1158440490 18:57470664-57470686 ACCTGCGGAACTGGGTGTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 80
1158440485_1158440493 17 Left 1158440485 18:57470641-57470663 CCTTGAAGAGCTAACACCACTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1158440493 18:57470681-57470703 TCAAGGTGACATGCGGTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
1158440485_1158440488 -8 Left 1158440485 18:57470641-57470663 CCTTGAAGAGCTAACACCACTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1158440488 18:57470656-57470678 ACCACTGCACCTGCGGAACTGGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158440485 Original CRISPR GCAGTGGTGTTAGCTCTTCA AGG (reversed) Intronic
902571505 1:17349953-17349975 GCAGTGCTGTTCCCTGTTCACGG + Intronic
902646023 1:17798426-17798448 GCAGAGGTGCTGGCTCTTAAAGG + Intronic
903183896 1:21618954-21618976 GCAGTGGTGGCAGCACTTCCCGG + Intronic
903967028 1:27097260-27097282 GTAGTGCTGTTGGCCCTTCATGG - Intergenic
904683041 1:32241931-32241953 GCAGTAGTGCTAGCACCTCAGGG - Intergenic
905786877 1:40765495-40765517 GCAGTGAAGTTAGCTCTTGAAGG + Intronic
909125240 1:71659922-71659944 GTTGTGGTTTTAGCTCTTTAAGG - Intronic
916952126 1:169791046-169791068 GCAGCGGTGTTAGATTCTCATGG - Intronic
921769636 1:219021402-219021424 GAAGTGGTGTCAGCAATTCAAGG - Intergenic
1063970626 10:11379125-11379147 GTAGGGGAGTTAGCTATTCAGGG + Intergenic
1066506326 10:36048610-36048632 GCAGTGGCCTTAGGTCTTCTTGG + Intergenic
1067259571 10:44676736-44676758 GCAGTGTTTCTAACTCTTCAGGG - Intergenic
1071387097 10:85132409-85132431 GCAGAGCTGTGAGCTCCTCATGG + Intergenic
1071920134 10:90340465-90340487 GCAGGGATGGTAGCTCTTCATGG + Intergenic
1073248268 10:102106725-102106747 GAGGTGGTGTTAGCACTTCCTGG + Intergenic
1073639883 10:105241209-105241231 GCAGTGGTGTTCCCTCTACCTGG + Intronic
1077768628 11:5190358-5190380 GCAGTGGCCTTAGCTGTTCTTGG - Intergenic
1077783933 11:5362152-5362174 GCAGTGCTGATAGCTCAGCATGG - Intronic
1079674506 11:23208781-23208803 GCTGTGGTGTTAGATTCTCAAGG - Intergenic
1081719762 11:45279843-45279865 GGAGTGGGGTTAGCAATTCATGG + Intronic
1083518382 11:63282813-63282835 GCAGTGGTGTTAGCAGTTATGGG + Intronic
1083782591 11:64925899-64925921 GCAGCGGTGTGAGCTCTTGCTGG - Exonic
1083836993 11:65276685-65276707 GCAGTAGTATTAACCCTTCAGGG + Intronic
1083846470 11:65337010-65337032 GCAGTGGTGTGATCTCTCCTGGG - Intronic
1086743388 11:90395750-90395772 CCTGTGGTGTTATCTCTTTAGGG + Intergenic
1087362234 11:97175628-97175650 GCACTGTTTTTAGCTCTTTAAGG - Intergenic
1087505418 11:99014359-99014381 GCAGTGGTGTTCTGTATTCACGG - Intergenic
1095857558 12:46877369-46877391 CCAGTGGTGTGAGCACTGCATGG + Intergenic
1095933176 12:47649614-47649636 GCAGTAGTGGAAGCTCTGCATGG - Intergenic
1096625155 12:52890620-52890642 GCAGTGGTGCAGGCTTTTCAGGG - Intergenic
1097098855 12:56571834-56571856 GCAGAGGTGTTGGCTTTGCAAGG + Exonic
1097190899 12:57219180-57219202 GCAGAGGTGTCAGCCGTTCATGG - Intronic
1099757508 12:86872458-86872480 TAAGTGCTGTTAGCTCTGCAAGG + Intergenic
1100330580 12:93578094-93578116 GCAGTGGTGATTGCTTTTTAGGG + Intronic
1100420118 12:94424426-94424448 GCAGAGGTGTTGGCTTTGCAAGG - Intronic
1102969991 12:117158703-117158725 TCAGTGGTCTTAACTCATCATGG + Intronic
1107832836 13:44389724-44389746 TCAGTGGTGTCACCTCTGCAGGG + Intronic
1108898076 13:55360454-55360476 GCTGTCGTCTTAGCTATTCAGGG - Intergenic
1114376611 14:22153134-22153156 GAAGTGGTGTTAGCTCTAGGGGG + Intergenic
1114929002 14:27443884-27443906 GCAGTGGTGCAATCTCTTCTCGG + Intergenic
1116042749 14:39705301-39705323 GGAGTGATGTTTGCTCCTCAGGG + Intergenic
1118119440 14:62822302-62822324 TCAGTGGTCTTAGGTCTTCTAGG - Intronic
1119825375 14:77653420-77653442 GCAGTGGTGTGATCTCGGCATGG - Intergenic
1124664620 15:31581638-31581660 GCAGTGGCCTGAGCTCTACATGG + Intronic
1129169698 15:73800088-73800110 GCAGTGGGGTCACCTCTTCAGGG - Intergenic
1130660741 15:85829892-85829914 TCAGTGGTGGTAACTCTCCAGGG - Intergenic
1130693096 15:86103791-86103813 GCGTTGGTGTTAGCTATTCTAGG + Intergenic
1130725055 15:86430615-86430637 GCAGTGTGGTTAGTTCTTCTGGG - Intronic
1131223807 15:90607554-90607576 GAAGTGGTGTTTGCGCTTCCCGG + Intronic
1131848241 15:96510814-96510836 GCAGTGGTGTGAGCACACCAAGG + Intergenic
1134667977 16:16033383-16033405 GCAGAGGTGTCAGCTGCTCACGG - Intronic
1143651328 17:8265788-8265810 GCAGTGCTGTGAGCCCCTCAGGG + Intronic
1147616656 17:41832815-41832837 GCAGTGGTGTGATCTCGTCTTGG - Intronic
1152157103 17:78641641-78641663 GCAGTGGTGGCAGTTCCTCAAGG - Intergenic
1153862094 18:9222282-9222304 GCAGTGGTGGTAGCTCTGCATGG - Intronic
1154188752 18:12209766-12209788 GCAGTGGTGTGATCTCGTCTCGG + Intergenic
1158440485 18:57470641-57470663 GCAGTGGTGTTAGCTCTTCAAGG - Intronic
1159731805 18:72035948-72035970 GCGGTGGTGTCAGCAATTCAAGG + Intergenic
1159879742 18:73847044-73847066 GCTGTAGTGTGAGGTCTTCAGGG - Intergenic
1162655569 19:12126555-12126577 GCAGTGGTATTAGATTTTCTTGG - Intronic
1164720736 19:30430010-30430032 AGAGTGGGGTTAGCTCTTTATGG + Intronic
926355055 2:12034079-12034101 CCATTGGTGTTACCTCTTCAGGG - Intergenic
930736177 2:54781258-54781280 GCAGTGGTGATAGATTTGCAAGG + Intronic
931498079 2:62833626-62833648 GCAGTGGTGTTGTTTTTTCAGGG - Intronic
933546449 2:83719071-83719093 GAAGTGGTGTCAGGTGTTCATGG - Intergenic
934139830 2:89035777-89035799 CCAGTGGTACTAGCTTTTCATGG - Intergenic
934229410 2:90164774-90164796 CCAGTGGTACTAGCTTTTCATGG + Intergenic
938769800 2:134491477-134491499 CCAGTTGTATTAGCTTTTCATGG + Intronic
943548476 2:189310603-189310625 GGAGTGCAGTTATCTCTTCAAGG - Intergenic
946414577 2:219533434-219533456 GCCGGGGTGTAAGCTCTCCAAGG - Intronic
946809397 2:223507612-223507634 GGAGGGGTGTTAGCTATGCAAGG + Intergenic
948887379 2:240891040-240891062 GCAGTGGTGTCAGATCTGGATGG + Intronic
1169179134 20:3546978-3547000 GCAGAACTGTTAGCTCCTCATGG - Intronic
1172068011 20:32235176-32235198 GCAGTGGGGATGGCTCTTGAGGG - Exonic
1173316834 20:41952123-41952145 GTAGTGGTCTTGGCTCTTCCAGG - Intergenic
1174101774 20:48132145-48132167 GCAGTTGTCTTAGCTCTTTGAGG + Intergenic
1174101943 20:48134251-48134273 GCAGTGCTGAGATCTCTTCAAGG - Intergenic
1176375701 21:6085995-6086017 GCAGCAGTGTTTGCTCTGCAGGG + Intergenic
1178791150 21:35701380-35701402 GGAGTGGAGGTTGCTCTTCAGGG - Intronic
1179747773 21:43452249-43452271 GCAGCAGTGTTTGCTCTGCAGGG - Intergenic
1181264771 22:21624510-21624532 GCAGTGGTGCTAACTCAGCAAGG + Intergenic
1182555544 22:31126670-31126692 CCAGTGGAGTGAGCTGTTCATGG + Exonic
1184562345 22:45270450-45270472 GCAGTGCTATTAGGCCTTCAGGG + Intergenic
1185254728 22:49826045-49826067 GCTGTGGTGTCACCTCTGCAGGG - Intronic
951707357 3:25556767-25556789 GCAGTGATGTTGCCTGTTCATGG + Intronic
955875007 3:63479742-63479764 GCATTGATGTTAACTCTTCTGGG - Intronic
959671283 3:108980394-108980416 GCAGTTGAGTTAGCATTTCATGG - Intronic
962206826 3:133441632-133441654 GCAGTAGTGCTACCTCTTTATGG - Intronic
966633935 3:182110835-182110857 GCAGTGTTGTTCTCTCTGCATGG + Intergenic
966860435 3:184228753-184228775 GCAGAGATGTTTTCTCTTCAGGG + Intronic
967941086 3:194767399-194767421 GCAGTGCTGTTAGCTCCCCATGG + Intergenic
970999022 4:22301591-22301613 TTAGTGATGTTAACTCTTCAGGG + Intergenic
979781083 4:124651728-124651750 GCAGTGGTGTAAGCGCGTCCGGG - Intergenic
983006581 4:162492057-162492079 GCAGTGCAGATATCTCTTCAAGG - Intergenic
986110231 5:4709270-4709292 ACAATGGTGTGAACTCTTCAGGG + Intergenic
990746495 5:58964258-58964280 TCAGTGGTGGTAACTCTCCATGG - Intergenic
990945666 5:61246431-61246453 ACAGTTGTGTTAATTCTTCATGG + Intergenic
994343427 5:98659257-98659279 GCACAATTGTTAGCTCTTCAGGG - Intergenic
997642612 5:135459180-135459202 GCATTGGTATCAGCTCCTCAAGG - Intergenic
1003367845 6:5493672-5493694 GCAGTAGTATTAGCTATTCACGG + Intronic
1004945167 6:20604233-20604255 GCAGGGTTGGGAGCTCTTCATGG + Intronic
1005006559 6:21293041-21293063 GGACTGCTGTCAGCTCTTCAAGG + Intergenic
1011266921 6:85531252-85531274 ACAGTGGTGTTATTTGTTCAAGG - Intronic
1012472449 6:99587662-99587684 GTAGTGGTGTTCCCACTTCAGGG + Intergenic
1014218001 6:118771433-118771455 TCAGTTGTGCAAGCTCTTCAGGG - Intergenic
1015058934 6:128938925-128938947 GCACTGTTGTTACCTCTTCAGGG + Intronic
1015582955 6:134746279-134746301 GCAGGAGTGTTAGCTCCTTATGG - Intergenic
1017613098 6:156213087-156213109 GCATTGGTGTTAGCATGTCAAGG + Intergenic
1019393071 7:800635-800657 CCTGTAGTGTTAGCTATTCATGG + Intergenic
1021658745 7:22897679-22897701 GCAGTGGGGTGAGCTCCTCCTGG + Intergenic
1022202810 7:28134058-28134080 GCAGGGGTGTCATCTCTTGATGG + Intronic
1023119467 7:36894750-36894772 GCTGTGTTGTGAGCTCCTCAGGG - Intronic
1024124966 7:46284340-46284362 GCAGTGGTGTTGGCTCAGGAAGG - Intergenic
1027199247 7:76052617-76052639 GCAGTGGTGTGATCTCCTCCTGG + Intronic
1034137949 7:148788867-148788889 GAAGTGGTGTCAGCTCTACTGGG + Intronic
1034472790 7:151264602-151264624 GCTGAGGAGTTAGGTCTTCAGGG - Intronic
1036600163 8:10253370-10253392 GCAGTGATTTAAGCTGTTCAAGG - Intronic
1037777604 8:21846138-21846160 GCAGTGCTGTCATCTTTTCATGG - Intergenic
1040562910 8:48540481-48540503 GCAGAGCTCTCAGCTCTTCATGG + Intergenic
1049018644 8:139939237-139939259 GCAGAGGTGTTATCTCTTCCAGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1051269117 9:15337730-15337752 TCAGGGTTGTGAGCTCTTCAAGG + Intergenic
1052826581 9:33180586-33180608 GCAGTGGTGTTAAATAATCATGG - Intergenic
1055877388 9:80959685-80959707 ATAATGGTGTTAGCTATTCATGG - Intergenic
1059157577 9:112003744-112003766 GCAGTGGTGGTTCCTCTTCAGGG + Intergenic
1187705662 X:22006995-22007017 CCATTGGTGTTAGATCTTAAGGG + Intergenic
1189675214 X:43454381-43454403 GCTGTGGTGGTAGCTGGTCAAGG + Intergenic
1193334760 X:80274762-80274784 GTACTGGTTTTATCTCTTCATGG - Intergenic
1193600269 X:83502146-83502168 GCTGTTGTGTTAGTTCTTCTGGG - Intergenic
1196710980 X:118762473-118762495 CCAGTTGTTTTAGCTCATCATGG + Intronic
1198325798 X:135571375-135571397 GCAGTGGTGATAATGCTTCAAGG + Intronic
1200375944 X:155780279-155780301 GCAGTTTAGTTAGTTCTTCAAGG - Exonic
1200683525 Y:6240923-6240945 GCAGTGTGGTTGGCTCTTTAAGG - Intergenic
1201049110 Y:9913463-9913485 GCAGTGTGGTTGGCTCTTTAAGG + Intergenic