ID: 1158441619

View in Genome Browser
Species Human (GRCh38)
Location 18:57479822-57479844
Sequence TGGCACACCCAGATGGGACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 320}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158441619_1158441634 22 Left 1158441619 18:57479822-57479844 CCCTGTCCCATCTGGGTGTGCCA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1158441634 18:57479867-57479889 ACCAAAGGGACTTCTCACAGGGG 0: 1
1: 0
2: 0
3: 12
4: 121
1158441619_1158441623 -4 Left 1158441619 18:57479822-57479844 CCCTGTCCCATCTGGGTGTGCCA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1158441623 18:57479841-57479863 GCCAGACCCCCTCAGTGAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 148
1158441619_1158441632 20 Left 1158441619 18:57479822-57479844 CCCTGTCCCATCTGGGTGTGCCA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1158441632 18:57479865-57479887 CCACCAAAGGGACTTCTCACAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1158441619_1158441633 21 Left 1158441619 18:57479822-57479844 CCCTGTCCCATCTGGGTGTGCCA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1158441633 18:57479866-57479888 CACCAAAGGGACTTCTCACAGGG 0: 1
1: 0
2: 7
3: 50
4: 417
1158441619_1158441630 8 Left 1158441619 18:57479822-57479844 CCCTGTCCCATCTGGGTGTGCCA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1158441630 18:57479853-57479875 CAGTGAGCAGGTCCACCAAAGGG 0: 1
1: 0
2: 1
3: 14
4: 98
1158441619_1158441629 7 Left 1158441619 18:57479822-57479844 CCCTGTCCCATCTGGGTGTGCCA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1158441629 18:57479852-57479874 TCAGTGAGCAGGTCCACCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158441619 Original CRISPR TGGCACACCCAGATGGGACA GGG (reversed) Exonic
900729794 1:4248977-4248999 TGGCACACCCAGAGGCCACATGG + Intergenic
901850312 1:12010936-12010958 TGGCAGAGCCAGAGGGGAGATGG + Intronic
902786682 1:18737135-18737157 GGGCAGGTCCAGATGGGACAGGG + Intronic
903812233 1:26041187-26041209 TGCCACACCCTGTGGGGACATGG - Intronic
903941817 1:26937188-26937210 TGGCACACCCAGAGAGGGTACGG - Intronic
904430353 1:30460228-30460250 CTGCACACCCAGCTGGGAGAAGG + Intergenic
905234108 1:36533930-36533952 TGGCAGTCCCAACTGGGACATGG + Intergenic
905487663 1:38315369-38315391 TGGCACTCCCAGGGGGGTCATGG + Intergenic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
907304683 1:53506981-53507003 TGGCACACCCAGGGGGCCCAGGG + Intronic
908984988 1:70006943-70006965 TGGCACACCCAGCAAGGACATGG - Intronic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG + Intergenic
909408309 1:75318002-75318024 TGGCACACCCAAATGAGAGTAGG - Intronic
911890956 1:103371263-103371285 TGGCACACCCAGGGAGGGCATGG + Intergenic
914351844 1:146846775-146846797 TGGCACACCCAGGGTGGAGATGG - Intergenic
917443579 1:175088004-175088026 TGGCACACCCACAGAGGCCATGG - Intronic
918217464 1:182404953-182404975 TGACACCCCCAGTGGGGACAAGG + Intergenic
920720145 1:208379706-208379728 TGGCACACCCAGGGAGGGCATGG + Intergenic
920786771 1:209050023-209050045 TGGCCCACCCAGGAGAGACAGGG + Intergenic
921013295 1:211163066-211163088 TGGCACACCCAGGAGCGACATGG - Intergenic
922006374 1:221534683-221534705 TGGCTCACCCAGAGAGGGCATGG - Intergenic
922791408 1:228313210-228313232 TGGCACGCCCAGAGAGGACATGG - Intronic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
923406017 1:233661371-233661393 TGGCATTCCTAGTTGGGACATGG - Intronic
924811435 1:247405949-247405971 TGGCACTCCATGATGTGACATGG - Intergenic
1062761681 10:27621-27643 TGGCCCACCCAGGTGTGGCACGG + Intergenic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1066520241 10:36209690-36209712 TGGCAGAACCAGTTGGGAAATGG - Intergenic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1069735350 10:70650351-70650373 TGGAGCACCCAGCTGGGACTGGG - Intergenic
1069831656 10:71285609-71285631 TGGCAGACCCAGCTGGGATCTGG - Intronic
1070637264 10:78139501-78139523 TGCCACAGCCAGCTGAGACAAGG - Intergenic
1071371700 10:84957889-84957911 TGGCACACCCAGATGGGGTGTGG + Intergenic
1072619451 10:97069945-97069967 GGGCAAACCCAGAAGGAACAAGG - Intronic
1074211375 10:111338405-111338427 TGGCAGAGCCAAAGGGGACATGG - Intergenic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1075184540 10:120243872-120243894 TGGCACCCCCAGAGAGGGCATGG - Intergenic
1075790484 10:125080712-125080734 TGGCCCTTCCAGATGGGCCATGG - Intronic
1076640239 10:131910934-131910956 GGGCCCACCCAGAGAGGACACGG + Intronic
1076796302 10:132799980-132800002 TGGCCCACCCAGGTGGAAGACGG - Intergenic
1077093622 11:790259-790281 TGGCAGTCCCAGATGGGACTTGG - Intergenic
1077196339 11:1282545-1282567 CGGCACACCAACATGGCACACGG + Intronic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1078099820 11:8323468-8323490 TGGCGAAGCCTGATGGGACATGG + Intergenic
1078908346 11:15708201-15708223 TGGCACAGCCAGCTGGCACGTGG + Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1080244364 11:30163088-30163110 TGGCACACCTAGGGAGGACATGG + Intergenic
1080931073 11:36811711-36811733 TGGCAGAGCCATATGGGAAAAGG - Intergenic
1083951283 11:65957839-65957861 AGCCACACCCACATGGGACCAGG - Intronic
1084621819 11:70276634-70276656 TGGCAAAACCAGCTGGTACAGGG + Intronic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1085351069 11:75798113-75798135 TGGTACACCCAGCTGGGGGAGGG + Intronic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1087145166 11:94803385-94803407 TAGCTCACCCACATGGGCCAAGG - Intronic
1089327466 11:117667076-117667098 TGGCAGGCTCAGGTGGGACAAGG + Intronic
1089687979 11:120169111-120169133 GGGCGGACCCAGAGGGGACATGG + Exonic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090030577 11:123202737-123202759 TGGCAGAAACAGGTGGGACAGGG + Intergenic
1090226815 11:125076661-125076683 TGGGACTGCCAGAGGGGACACGG + Intronic
1093254534 12:16850587-16850609 TGGCACACCAAGAGAGGGCATGG - Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1094811434 12:34142553-34142575 TGGCCCACCCAGGTGTGGCATGG + Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095729024 12:45485466-45485488 AGGCACACCCATATAAGACAGGG + Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1096800063 12:54104524-54104546 TGGTACTCCCTGATGGGGCAGGG + Intergenic
1097398611 12:59104174-59104196 TGTCCCGCACAGATGGGACACGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099554334 12:84091871-84091893 TGGCACACCCAGTTCAGCCACGG - Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1101395315 12:104342023-104342045 TGCCACACCTAGAGAGGACATGG - Intronic
1103266058 12:119631276-119631298 AGGCTCACCCAGATGGGTGAGGG + Intronic
1104649643 12:130522412-130522434 TGGCACCCGCAGGAGGGACAGGG - Intronic
1106114898 13:26809044-26809066 TGACACACCCAGAGAGGAAAAGG - Intergenic
1107018811 13:35731039-35731061 TGGCACACCCAGAGGGGGCTTGG - Intergenic
1107861768 13:44667619-44667641 TGGCTCTCACAGATGGGGCAGGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1109446123 13:62443071-62443093 TGGCACACCGAGATGGGAGGAGG - Intergenic
1110488408 13:76073130-76073152 TGGCACGTCCAGAGGGGGCATGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111562220 13:89966616-89966638 TGAGACACCAAGATGGGAAAGGG + Intergenic
1112941401 13:104866543-104866565 TGGGAAACCCAGAAGGGAGATGG - Intergenic
1114766152 14:25373025-25373047 TGGCACACTCAGGGAGGACATGG + Intergenic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1117969886 14:61241246-61241268 TGGTGCACCCAGAGAGGACATGG - Intronic
1119028561 14:71173871-71173893 TGGCATGCCCAGGTGGGAGAGGG - Intergenic
1119391822 14:74296074-74296096 TGGGCCACTCAGATTGGACAGGG - Intronic
1121230449 14:92353866-92353888 CGGCACAGGCAGCTGGGACAGGG - Intronic
1122178532 14:99938176-99938198 TGGCACAACCTGATAGGAGAGGG - Intronic
1122317468 14:100834670-100834692 TGGGACACCCTGAGGAGACACGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1123773081 15:23548653-23548675 TGGCACCACCAGAGGGGACCAGG + Intergenic
1124854908 15:33378317-33378339 TGGGACAGGCAGAGGGGACATGG - Intronic
1126596899 15:50392127-50392149 TGGCACACGCAGAGAGGGCATGG + Intergenic
1128958628 15:71975911-71975933 TGGTACACCCAGGGAGGACATGG + Intronic
1129275507 15:74442751-74442773 TGGATCCTCCAGATGGGACATGG - Intergenic
1129709395 15:77812820-77812842 TGGCACAGCCATCAGGGACAGGG + Intronic
1131408460 15:92185879-92185901 TGGAACACCCAGGTAGGACAGGG - Intergenic
1132359431 15:101200590-101200612 CTGCACCCCCAGATGGGTCAGGG + Intronic
1133537026 16:6712293-6712315 TGGCAGACCCAGATGACAGAAGG - Intronic
1133915959 16:10110200-10110222 TGGCACACGCAGAGGCTACAGGG + Intronic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1135284421 16:21181123-21181145 TGGGATATGCAGATGGGACAGGG + Intergenic
1138804971 16:60081168-60081190 GGTCACACACAGATGGGACGCGG - Intergenic
1139583085 16:67884752-67884774 TCCAACACCCAGATGGGAAAAGG - Intergenic
1140485372 16:75289197-75289219 TGACACACCCATTTGGGACTTGG + Intergenic
1142806320 17:2372887-2372909 GGGCTCACCCAGCTGGGCCACGG + Intronic
1143695402 17:8611745-8611767 TGTGAGACCCAGATGGGACGAGG + Intronic
1144217459 17:13068915-13068937 TGGCACACCAAGAAAGGGCATGG - Intergenic
1144389847 17:14783801-14783823 TGGCCCCTCCAGATGGGCCACGG - Intergenic
1145987302 17:29055654-29055676 TGGCACACCCAGAGGGGCACGGG + Intronic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1148552209 17:48557306-48557328 TGGTGCATCCAGATGGGAGAAGG - Intronic
1149571446 17:57675177-57675199 TGGCACACCCACAGGCCACAAGG - Intronic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1152593795 17:81228527-81228549 TAGCCCACCCCGATGGGACGGGG + Exonic
1152898665 17:82927891-82927913 TTGCGGACCCTGATGGGACAAGG - Exonic
1152954588 18:27951-27973 TGGCCCACCCAGGTGTGGCACGG + Intergenic
1153028219 18:690036-690058 TGGCTCACCTGGAGGGGACATGG + Intronic
1153684105 18:7528216-7528238 TGGGCCACCCAGATGGGAGCTGG - Intergenic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155791042 18:29971324-29971346 TGGCACAGCCAGAAAGGAGATGG + Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1157517495 18:48321221-48321243 TGACACACCCACAAGGGAGAGGG - Intronic
1158112069 18:53951491-53951513 TGGCACATGCATATGGGACATGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1158495470 18:57951455-57951477 TGGCACACCCAGATGCTTCATGG + Intergenic
1159927654 18:74283157-74283179 TGGCACATGCAGAGGGGATATGG + Intronic
1161726593 19:5932953-5932975 TGCCAAAGGCAGATGGGACAAGG + Intronic
1161800079 19:6412548-6412570 TGGCACACCTGCATGGGTCAGGG + Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164506555 19:28865981-28866003 GGGCACACCCAGAAAGGGCATGG + Intergenic
1164619981 19:29689647-29689669 TGGCATCCCCTGATGGGAGAGGG + Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1165754207 19:38282665-38282687 GGGCACACCAAGATGGGCCTGGG - Intronic
1166117395 19:40664088-40664110 AGGCACAGGCAGATGGGTCAGGG + Intergenic
1166302239 19:41917878-41917900 TCGTGCACCCAGATGGGACAGGG - Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168652455 19:58100350-58100372 TGGCTCACCCAGACGGTACATGG - Intronic
927164010 2:20298949-20298971 TGGCACACCCAGGGAGGGCATGG + Intronic
928248437 2:29652795-29652817 TGTCACACCCAGAGAGGGCATGG + Intronic
928702919 2:33917461-33917483 TGGCACAACCAGCTGTGGCAGGG + Intergenic
928854520 2:35788591-35788613 TGGAGCACCCAGGTGGGACTGGG - Intergenic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
929950983 2:46409274-46409296 TGACACACCCAGACGGGACCTGG - Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931059081 2:58505978-58506000 TTTTACACCCAGATGGGACCAGG + Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932461775 2:71886676-71886698 TGGCACATCCAGAGAAGACAGGG - Intergenic
932651904 2:73566983-73567005 TGGCAGGCCCAGAGAGGACATGG - Intronic
933553834 2:83807870-83807892 TGGCACACCCAGGGAGGGCATGG - Intergenic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
937568830 2:123332814-123332836 TGGCCCACCCAGGAGTGACATGG + Intergenic
939952469 2:148491050-148491072 TGGCACACACAGCTGGGAAGGGG + Intronic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
942743261 2:179203496-179203518 TAGCACACCCAGAGAGGCCATGG + Intronic
943670798 2:190658304-190658326 TGGCACTCGCACATGGCACAGGG - Intronic
945020326 2:205564568-205564590 TGGCACATCCTTAGGGGACATGG + Intronic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
946238647 2:218340816-218340838 TGGCAAGCCCAGCTGGGACAAGG - Intronic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1169272054 20:4208042-4208064 TGGCACACCCAGAGGAGGCGTGG + Intergenic
1170538062 20:17361490-17361512 TGGCAGACCCAGATGGGTGATGG - Intronic
1172099950 20:32479323-32479345 TGGCTCACCCAGAGGTCACAGGG + Intronic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1175460313 20:59147433-59147455 GGATACACCCAGAGGGGACAAGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178924993 21:36767343-36767365 TGGCTCACACAGGAGGGACAGGG + Intronic
1179914142 21:44465311-44465333 TGTCCCTCCCAGATGGGACAGGG + Intergenic
1179994867 21:44969380-44969402 TGGCGCTCCCAGAAGGGAGAGGG + Intronic
1182249141 22:28985662-28985684 TGGCACACCCAGAGGTGACCAGG - Intronic
1183568371 22:38633006-38633028 AGGCACTCCCAGATGGGGCAAGG + Intronic
1184366318 22:44053881-44053903 TGGCACGCCCAGAGAGGGCATGG - Intronic
1184627046 22:45743389-45743411 TGTAACACCCAGCTGGAACAAGG - Intronic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
1185322758 22:50209457-50209479 TCGCCCACCCACATGGAACATGG - Intronic
950118645 3:10467500-10467522 TGGCAGACACAGTTGGCACATGG + Intronic
950416732 3:12873142-12873164 TGGCACTCCCAGAGGGGACACGG - Intergenic
950708935 3:14801678-14801700 AGGGACACCCAGAAGGAACAGGG + Intergenic
951196470 3:19828616-19828638 CGGCACACCCAGCAGGGGCATGG - Intergenic
951233009 3:20201317-20201339 TGGCACACACAGCTGGACCATGG + Intergenic
951460864 3:22950238-22950260 TGCCACAACCAGAAGGGAGAGGG + Intergenic
952535982 3:34309542-34309564 TGGTACACCCAGATGCCACCAGG - Intergenic
953556399 3:43949854-43949876 TGGGACACCAAGATGGGCCTGGG + Intergenic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958264927 3:91426908-91426930 TGGAACACCCAGAGAGGGCATGG + Intergenic
958445970 3:94215561-94215583 TGGCATACCCAGAGAGCACATGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
959798878 3:110466045-110466067 TGGGAAAGCCAGTTGGGACAAGG - Intergenic
960845435 3:122000451-122000473 TGGCACACCTGGAGAGGACATGG + Intronic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961992211 3:131204205-131204227 TGGCACACCCAGGAAGGGCATGG + Intronic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
964111773 3:153095633-153095655 TGGCACACCCAGAAAAGGCATGG - Intergenic
966269671 3:178090168-178090190 TGGCCCACCCAGGAGTGACATGG + Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
966543252 3:181115636-181115658 TGGCATACCCAGATAGGAACAGG + Intergenic
967661230 3:192112869-192112891 TGGCACACCCAAAAAGAACATGG + Intergenic
967723238 3:192837415-192837437 TGGGAAGCCCAGGTGGGACAGGG - Intronic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
968359132 3:198134187-198134209 TGGCCCACCCAGGTGTGGCACGG - Intergenic
968661235 4:1799668-1799690 TGCCCCTCCCAGATGGGGCAGGG - Intronic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
970628874 4:17919972-17919994 TGGCACACCCAGGGAGGGCATGG + Intronic
975530454 4:75394677-75394699 GGGCAATCCCAGATGGGAAAAGG + Intergenic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
980765770 4:137301745-137301767 TGGCACACCCAGGGAGGGCATGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
981516274 4:145613233-145613255 GGGCACACCAGGATGGGGCAGGG - Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985630679 5:1012467-1012489 TGGCACACTCAGAAGGGCCGTGG - Intronic
986705528 5:10451594-10451616 CGCCACACTCAGATGTGACATGG - Intronic
986989242 5:13532303-13532325 TGGCAAACACCGATGGGATAAGG + Intergenic
988694566 5:33608072-33608094 TGGAGCACCCAGAGGGGGCATGG + Intronic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
992009684 5:72514052-72514074 TGGCATGCCCAGAGAGGACATGG - Intergenic
993660306 5:90625255-90625277 TTACATACCCAAATGGGACAAGG + Intronic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994787857 5:104187160-104187182 TGGAGCACCCAGGTGGGACTGGG - Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
1000739098 5:164943511-164943533 TGGTACACCCAGTTGGGTGAGGG + Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1002476991 5:179472668-179472690 TGGCAAAGCCAGAAGGGAGATGG + Intergenic
1002643326 5:180640844-180640866 TGCCATACCCTGGTGGGACAGGG + Intronic
1003311133 6:4970896-4970918 TGGCACACCCAGCTGAGGCTCGG + Intergenic
1003465617 6:6377203-6377225 TTGCAGACCCAAATGTGACATGG + Intergenic
1004207021 6:13600954-13600976 TGGGATACCCTGATGGGAGAGGG + Intronic
1005388754 6:25312175-25312197 GAGCACACCCAGATGGGAGGGGG - Intronic
1006691949 6:35895930-35895952 TGGTACACCCAGAGAGGGCATGG + Intronic
1007338157 6:41170289-41170311 TGGTGCACCCAGAAAGGACATGG - Intergenic
1008990456 6:57595752-57595774 TGGAACACCCAGAGAGGGCATGG - Intronic
1009179032 6:60494298-60494320 TGGAACACCCAGAGAGGGCATGG - Intergenic
1010238130 6:73591960-73591982 TGGCACGCCCAGAGAGGGCATGG - Intergenic
1011985075 6:93433209-93433231 TGGCATTCCAAGATGGCACATGG - Intergenic
1013010628 6:106116755-106116777 AGGCACACTCTGATGGGATAGGG - Intergenic
1013130968 6:107232347-107232369 AGGCCCACCCAGATGGAGCATGG - Intronic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1018561248 6:165102807-165102829 TGGCACACCCAGCTTAGCCATGG + Intergenic
1018759827 6:166884282-166884304 TGGCGCATCCAGAGGGAACATGG + Intronic
1020555375 7:9663883-9663905 TGAGACAGCCAGATGGGAGAGGG - Intergenic
1021068256 7:16203649-16203671 TGTCAAACCCAGATGGTAAAAGG - Intronic
1021745620 7:23738288-23738310 TGGCACACTCAGAAAGGGCATGG - Intronic
1021920687 7:25481952-25481974 TGGCAAAGCCTGATGGGAAAGGG + Intergenic
1021959119 7:25854723-25854745 TGGCACCGCCAGATGGCATAAGG - Intergenic
1022607085 7:31825906-31825928 GGGCACATCTAGATGGGAGAGGG + Intronic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1023043425 7:36192383-36192405 TAGCATGCCCAGATGGGGCAGGG + Intronic
1023521644 7:41055658-41055680 TGGTACCACCAGATGTGACAGGG + Intergenic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1026771933 7:73207649-73207671 TGGCACACGCGGATAGGGCACGG - Intergenic
1026853134 7:73737140-73737162 TGGCACCCCCAGACCGCACAAGG - Intronic
1027012801 7:74761045-74761067 TGGCACACGCGGATAGGGCACGG - Intergenic
1027075239 7:75185008-75185030 TGGCACACGCGGATAGGGCACGG + Intergenic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1028780179 7:94727254-94727276 TGGCACTACCAGCTGTGACAGGG + Intergenic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1030763084 7:113375317-113375339 TTGCAAAGCCAGATGGGATAAGG + Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1032701147 7:134380431-134380453 TGTCACATCCAGATGGAATAAGG + Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1035334327 7:158115928-158115950 TGCCACCCTCAGATGGAACAGGG + Intronic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1036385326 8:8274323-8274345 TGGCACACTCAGGTAGGACAGGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1039125819 8:34200536-34200558 CGGCACACCAACATGGCACATGG - Intergenic
1039229725 8:35430318-35430340 TGGCACACCCTGAGAGGGCATGG + Intronic
1041179978 8:55237003-55237025 AAGCACAACCAGAGGGGACATGG - Intronic
1042897978 8:73692133-73692155 TGGCACACCCAGACAGGGCTTGG + Intronic
1042929348 8:73997880-73997902 TGGTGCACCCAGAGAGGACATGG - Intronic
1043066095 8:75571726-75571748 ACGCACACCCAGAAGGGAGATGG - Intergenic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1045295086 8:100865590-100865612 TTGGACACCCAGGTGGGACCAGG + Intergenic
1045331899 8:101162370-101162392 TGGTACACCCAGAGAGGGCATGG + Intergenic
1046839114 8:118837971-118837993 TGGCACACCCAGAAAAGGCAGGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1047704588 8:127484734-127484756 TGAGACAGCCAGATGGGAAAGGG - Intergenic
1049256052 8:141614457-141614479 TGGTACAGCCAGAGTGGACAAGG + Intergenic
1049734876 8:144199586-144199608 TGGCACCTCCAGGTGGGTCATGG - Intronic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1054968785 9:71060694-71060716 TGACAAATCCATATGGGACAGGG + Intronic
1055720426 9:79167184-79167206 CGGCACTCCCATTTGGGACATGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056363729 9:85883018-85883040 TGTCCCGCACAGATGGGACATGG - Intergenic
1056907681 9:90667177-90667199 TGGCCCACCCAGGAGTGACATGG - Intergenic
1056956516 9:91086086-91086108 TGGCACACTCAGAGGGGGCATGG + Intergenic
1057526849 9:95810592-95810614 TGGCACACCCGGAGAGGGCATGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057815689 9:98292423-98292445 GGGCACACCCAGTTGGGATAAGG - Intronic
1058784868 9:108377048-108377070 TGGAACACCCAGAGAGGTCATGG + Intergenic
1059754794 9:117282446-117282468 TGGCCCACACTAATGGGACAGGG + Intronic
1060063217 9:120479950-120479972 TAGCACATTCAGAGGGGACAAGG + Intronic
1062006202 9:134239715-134239737 TGGCGCTCCGGGATGGGACATGG - Intergenic
1062370979 9:136238569-136238591 TGGCACAGCCAGGTGGGAGGAGG - Intronic
1062417906 9:136462588-136462610 TGGCACACACAGCAGGGGCACGG + Intronic
1062743759 9:138197323-138197345 TGGCCCACCCAGGTGTGGCACGG - Intergenic
1185956889 X:4500847-4500869 AGACAAACCCAGATGGGTCATGG - Intergenic
1191198828 X:57755215-57755237 TGGAACACCCAGATGTGTAAAGG + Intergenic
1191580691 X:62757680-62757702 TGGCACTACCAGCTGTGACAGGG + Intergenic
1192729176 X:73785474-73785496 TGGCACACCCAGGGAGGGCATGG - Intergenic
1195750754 X:108160528-108160550 TGGCTCATCCCGATGGGACACGG + Exonic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197424113 X:126273477-126273499 TGGCACACCCAGGAGCCACATGG - Intergenic
1197459614 X:126724144-126724166 TGGCGGACCCAGAAGGGAAATGG - Intergenic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198705339 X:139442953-139442975 TGGCCCACCCAGAAGTGATATGG + Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200354848 X:155537724-155537746 TGGCACAGAGAGAGGGGACAAGG - Intronic
1200759358 Y:7023437-7023459 TTCCACACCCAGAAGGGACTAGG + Intronic
1200971372 Y:9155991-9156013 TTTCAGACCCAGATGAGACAGGG + Intergenic
1201745302 Y:17365772-17365794 TGACAAACCCAAATGGGTCATGG - Intergenic