ID: 1158445010

View in Genome Browser
Species Human (GRCh38)
Location 18:57511929-57511951
Sequence TGCCCTCTGCAGGGAATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158445010_1158445020 26 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data
1158445010_1158445019 10 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445019 18:57511962-57511984 ATGAGTGAGGTGGAGGAGCAAGG No data
1158445010_1158445016 0 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445016 18:57511952-57511974 AGGCCTGATGATGAGTGAGGTGG No data
1158445010_1158445018 3 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445018 18:57511955-57511977 CCTGATGATGAGTGAGGTGGAGG No data
1158445010_1158445015 -3 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445015 18:57511949-57511971 GCAAGGCCTGATGATGAGTGAGG No data
1158445010_1158445021 27 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445021 18:57511979-57512001 GCAAGGATGCCCCTTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158445010 Original CRISPR TGCCCTCTGCAGGGAATGGT AGG (reversed) Intergenic
No off target data available for this crispr