ID: 1158445013

View in Genome Browser
Species Human (GRCh38)
Location 18:57511938-57511960
Sequence ATCAGGCCTTGCCCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158445013_1158445018 -6 Left 1158445013 18:57511938-57511960 CCCTGCAGAGGGCAAGGCCTGAT No data
Right 1158445018 18:57511955-57511977 CCTGATGATGAGTGAGGTGGAGG No data
1158445013_1158445016 -9 Left 1158445013 18:57511938-57511960 CCCTGCAGAGGGCAAGGCCTGAT No data
Right 1158445016 18:57511952-57511974 AGGCCTGATGATGAGTGAGGTGG No data
1158445013_1158445020 17 Left 1158445013 18:57511938-57511960 CCCTGCAGAGGGCAAGGCCTGAT No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data
1158445013_1158445021 18 Left 1158445013 18:57511938-57511960 CCCTGCAGAGGGCAAGGCCTGAT No data
Right 1158445021 18:57511979-57512001 GCAAGGATGCCCCTTCTCATGGG No data
1158445013_1158445019 1 Left 1158445013 18:57511938-57511960 CCCTGCAGAGGGCAAGGCCTGAT No data
Right 1158445019 18:57511962-57511984 ATGAGTGAGGTGGAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158445013 Original CRISPR ATCAGGCCTTGCCCTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr