ID: 1158445017

View in Genome Browser
Species Human (GRCh38)
Location 18:57511955-57511977
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158445017_1158445021 1 Left 1158445017 18:57511955-57511977 CCTGATGATGAGTGAGGTGGAGG No data
Right 1158445021 18:57511979-57512001 GCAAGGATGCCCCTTCTCATGGG No data
1158445017_1158445020 0 Left 1158445017 18:57511955-57511977 CCTGATGATGAGTGAGGTGGAGG No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158445017 Original CRISPR CCTCCACCTCACTCATCATC AGG (reversed) Intergenic
No off target data available for this crispr