ID: 1158445020

View in Genome Browser
Species Human (GRCh38)
Location 18:57511978-57512000
Sequence AGCAAGGATGCCCCTTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158445010_1158445020 26 Left 1158445010 18:57511929-57511951 CCTACCATTCCCTGCAGAGGGCA No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data
1158445012_1158445020 22 Left 1158445012 18:57511933-57511955 CCATTCCCTGCAGAGGGCAAGGC No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data
1158445013_1158445020 17 Left 1158445013 18:57511938-57511960 CCCTGCAGAGGGCAAGGCCTGAT No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data
1158445014_1158445020 16 Left 1158445014 18:57511939-57511961 CCTGCAGAGGGCAAGGCCTGATG No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data
1158445017_1158445020 0 Left 1158445017 18:57511955-57511977 CCTGATGATGAGTGAGGTGGAGG No data
Right 1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158445020 Original CRISPR AGCAAGGATGCCCCTTCTCA TGG Intergenic
No off target data available for this crispr