ID: 1158447476

View in Genome Browser
Species Human (GRCh38)
Location 18:57533711-57533733
Sequence GGGCCTACATGCTGGCACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158447476_1158447485 8 Left 1158447476 18:57533711-57533733 CCGCTGTGCCAGCATGTAGGCCC No data
Right 1158447485 18:57533742-57533764 CCCTCCTGCTGGCCTTACGCGGG No data
1158447476_1158447483 7 Left 1158447476 18:57533711-57533733 CCGCTGTGCCAGCATGTAGGCCC No data
Right 1158447483 18:57533741-57533763 ACCCTCCTGCTGGCCTTACGCGG No data
1158447476_1158447488 13 Left 1158447476 18:57533711-57533733 CCGCTGTGCCAGCATGTAGGCCC No data
Right 1158447488 18:57533747-57533769 CTGCTGGCCTTACGCGGGCCAGG No data
1158447476_1158447479 -3 Left 1158447476 18:57533711-57533733 CCGCTGTGCCAGCATGTAGGCCC No data
Right 1158447479 18:57533731-57533753 CCCTCCCAACACCCTCCTGCTGG No data
1158447476_1158447489 14 Left 1158447476 18:57533711-57533733 CCGCTGTGCCAGCATGTAGGCCC No data
Right 1158447489 18:57533748-57533770 TGCTGGCCTTACGCGGGCCAGGG No data
1158447476_1158447490 18 Left 1158447476 18:57533711-57533733 CCGCTGTGCCAGCATGTAGGCCC No data
Right 1158447490 18:57533752-57533774 GGCCTTACGCGGGCCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158447476 Original CRISPR GGGCCTACATGCTGGCACAG CGG (reversed) Intergenic