ID: 1158448179

View in Genome Browser
Species Human (GRCh38)
Location 18:57539471-57539493
Sequence ATTATTTTCTAGAACAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158448179_1158448180 19 Left 1158448179 18:57539471-57539493 CCATCACTGTTCTAGAAAATAAT No data
Right 1158448180 18:57539513-57539535 AAACATAAAAGTAAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158448179 Original CRISPR ATTATTTTCTAGAACAGTGA TGG (reversed) Intergenic
No off target data available for this crispr