ID: 1158448180

View in Genome Browser
Species Human (GRCh38)
Location 18:57539513-57539535
Sequence AAACATAAAAGTAAGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158448179_1158448180 19 Left 1158448179 18:57539471-57539493 CCATCACTGTTCTAGAAAATAAT No data
Right 1158448180 18:57539513-57539535 AAACATAAAAGTAAGCTGCCAGG No data
1158448178_1158448180 20 Left 1158448178 18:57539470-57539492 CCCATCACTGTTCTAGAAAATAA No data
Right 1158448180 18:57539513-57539535 AAACATAAAAGTAAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158448180 Original CRISPR AAACATAAAAGTAAGCTGCC AGG Intergenic
No off target data available for this crispr