ID: 1158453953

View in Genome Browser
Species Human (GRCh38)
Location 18:57590626-57590648
Sequence GGGTCTTTGCAGACGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158453953_1158453960 14 Left 1158453953 18:57590626-57590648 CCTGACTGCGTCTGCAAAGACCC No data
Right 1158453960 18:57590663-57590685 TTCATGTTTACAGGTACCTGGGG No data
1158453953_1158453958 12 Left 1158453953 18:57590626-57590648 CCTGACTGCGTCTGCAAAGACCC No data
Right 1158453958 18:57590661-57590683 AGTTCATGTTTACAGGTACCTGG No data
1158453953_1158453957 5 Left 1158453953 18:57590626-57590648 CCTGACTGCGTCTGCAAAGACCC No data
Right 1158453957 18:57590654-57590676 CCAAATAAGTTCATGTTTACAGG No data
1158453953_1158453962 20 Left 1158453953 18:57590626-57590648 CCTGACTGCGTCTGCAAAGACCC No data
Right 1158453962 18:57590669-57590691 TTTACAGGTACCTGGGGGCTAGG No data
1158453953_1158453961 15 Left 1158453953 18:57590626-57590648 CCTGACTGCGTCTGCAAAGACCC No data
Right 1158453961 18:57590664-57590686 TCATGTTTACAGGTACCTGGGGG No data
1158453953_1158453959 13 Left 1158453953 18:57590626-57590648 CCTGACTGCGTCTGCAAAGACCC No data
Right 1158453959 18:57590662-57590684 GTTCATGTTTACAGGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158453953 Original CRISPR GGGTCTTTGCAGACGCAGTC AGG (reversed) Intergenic