ID: 1158456070

View in Genome Browser
Species Human (GRCh38)
Location 18:57608892-57608914
Sequence TAGAAAAAGCAAGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2031
Summary {0: 1, 1: 2, 2: 23, 3: 247, 4: 1758}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158456062_1158456070 20 Left 1158456062 18:57608849-57608871 CCTCAATGTGGGTGGGCACCACC 0: 9
1: 96
2: 655
3: 1259
4: 1719
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758
1158456065_1158456070 -1 Left 1158456065 18:57608870-57608892 CCCAATCAGCTACCAGCCTGGCT 0: 1
1: 0
2: 10
3: 39
4: 224
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758
1158456060_1158456070 24 Left 1158456060 18:57608845-57608867 CCACCCTCAATGTGGGTGGGCAC 0: 73
1: 537
2: 1126
3: 1214
4: 1090
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758
1158456061_1158456070 21 Left 1158456061 18:57608848-57608870 CCCTCAATGTGGGTGGGCACCAC 0: 8
1: 105
2: 589
3: 1156
4: 1293
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758
1158456063_1158456070 2 Left 1158456063 18:57608867-57608889 CCACCCAATCAGCTACCAGCCTG 0: 1
1: 1
2: 4
3: 70
4: 573
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758
1158456059_1158456070 25 Left 1158456059 18:57608844-57608866 CCCACCCTCAATGTGGGTGGGCA 0: 71
1: 535
2: 1112
3: 1055
4: 825
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758
1158456066_1158456070 -2 Left 1158456066 18:57608871-57608893 CCAATCAGCTACCAGCCTGGCTA 0: 1
1: 1
2: 22
3: 84
4: 237
Right 1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG 0: 1
1: 2
2: 23
3: 247
4: 1758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158456070 Original CRISPR TAGAAAAAGCAAGAGGAAGA AGG Intronic
Too many off-targets to display for this crispr