ID: 1158457303

View in Genome Browser
Species Human (GRCh38)
Location 18:57619531-57619553
Sequence TGGTTAAAAGTTCCTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158457303_1158457305 -9 Left 1158457303 18:57619531-57619553 CCCAAGGAAGGAACTTTTAACCA 0: 1
1: 0
2: 0
3: 17
4: 230
Right 1158457305 18:57619545-57619567 TTTTAACCATCTTCCTTATGTGG 0: 1
1: 0
2: 0
3: 16
4: 242
1158457303_1158457308 7 Left 1158457303 18:57619531-57619553 CCCAAGGAAGGAACTTTTAACCA 0: 1
1: 0
2: 0
3: 17
4: 230
Right 1158457308 18:57619561-57619583 TATGTGGCAGTTATAGCCAATGG 0: 1
1: 0
2: 0
3: 11
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158457303 Original CRISPR TGGTTAAAAGTTCCTTCCTT GGG (reversed) Intronic
901711588 1:11119803-11119825 TTCTTTAAAGTTTCTTCCTTTGG - Intronic
902057530 1:13614615-13614637 TGTTCCAAAGTTCCTTACTTGGG + Intronic
903903787 1:26668662-26668684 TTTTTAAATGTTTCTTCCTTGGG + Intergenic
907467621 1:54649703-54649725 AGGTTAAAAATGCCTCCCTTTGG + Intronic
908826702 1:68140242-68140264 TGGTTAAGAATACCTTCTTTTGG - Intronic
909754525 1:79207458-79207480 TCGTTAAAAGTATGTTCCTTTGG - Intergenic
910609275 1:89123594-89123616 TAGTTAAAAGTTCTTGTCTTTGG + Intronic
910656365 1:89623057-89623079 TGGTTAAATGCTCCTCCTTTTGG + Intergenic
910839980 1:91552022-91552044 TGCTTAAATGTTGCTTCCTTAGG - Intergenic
912195132 1:107389016-107389038 TGCCTAAAACTTACTTCCTTTGG + Intronic
912589435 1:110800347-110800369 TAGTTCAAACTTCCATCCTTGGG + Intergenic
913711153 1:121484951-121484973 TGGTTCAAATTTGCTTCATTGGG + Intergenic
916227399 1:162502409-162502431 TGGGTAAAAATTGCTTTCTTGGG + Intronic
918367753 1:183826819-183826841 TGTTTAAAGGGTCCCTCCTTGGG + Intronic
919227459 1:194724913-194724935 TTCTTAAAAGTCCCTTCCTGAGG - Intergenic
921901158 1:220452563-220452585 TGGCCAAAAGTTCCTTTCTTTGG - Intergenic
923224792 1:231929408-231929430 GGGTTAAAAATACATTCCTTTGG - Intronic
923692905 1:236213443-236213465 TGGTTAAAAGTGCAACCCTTGGG + Intronic
924158533 1:241206480-241206502 TATTTAAAAGTTCATTCTTTGGG - Intronic
924352102 1:243125462-243125484 AGGTTAAAATTTTCTTCATTAGG - Exonic
1063627908 10:7707917-7707939 TGTTTAAAAGTTCCTTTCCACGG - Intronic
1064023870 10:11830996-11831018 AGGTTAAAAGTTTCATGCTTTGG + Intronic
1064805676 10:19128755-19128777 TGGTTAAAACTTACTTGTTTGGG + Intronic
1065101791 10:22338418-22338440 TAGTGAAAAGTTCCTTGCTACGG + Intergenic
1065181625 10:23131947-23131969 TCATAAATAGTTCCTTCCTTGGG - Intergenic
1068733189 10:60383085-60383107 TGGTTGTAAGTTTCTTGCTTGGG - Intronic
1070357437 10:75654129-75654151 TGGTTGAAAGATTTTTCCTTTGG + Intronic
1072573491 10:96678657-96678679 AGGTAGAAAATTCCTTCCTTGGG + Intronic
1075057908 10:119233657-119233679 GGGTTAAAAGTCACATCCTTAGG + Intronic
1075838869 10:125479978-125480000 AGGTTAAAAGTTCATTTCCTTGG - Intergenic
1079727805 11:23897998-23898020 TAGTTAAATGTTCCCACCTTGGG - Intergenic
1079823210 11:25158395-25158417 AGGGTAAAAGTTTTTTCCTTTGG + Intergenic
1081266862 11:41035098-41035120 TGTTTAAAAAATTCTTCCTTTGG + Intronic
1082687407 11:56258180-56258202 TGATTAACACATCCTTCCTTGGG - Intergenic
1084958718 11:72704805-72704827 TGGTAATCAGTTCCTTCATTCGG + Intronic
1085842766 11:80031706-80031728 GGGTTAATACTTACTTCCTTAGG - Intergenic
1086597304 11:88588303-88588325 TTGTTAAAAGCACCTTGCTTAGG + Intronic
1088601058 11:111476028-111476050 GTGTTAAGAGATCCTTCCTTGGG - Intronic
1088632943 11:111791789-111791811 AGCTTAAAAGTTACCTCCTTTGG + Intronic
1088842838 11:113641114-113641136 TGCTTAAAAGTTCTTGACTTTGG + Intergenic
1089374589 11:117985760-117985782 TGGTTAAAAGCCTCTTTCTTGGG + Intergenic
1090447658 11:126777628-126777650 TGGTAAAAAGTGACTTGCTTTGG - Intronic
1091366298 11:135023427-135023449 TGCTTAAGAGTTGTTTCCTTTGG - Intergenic
1093726725 12:22521305-22521327 TGGACGTAAGTTCCTTCCTTAGG - Intronic
1095073938 12:37893584-37893606 TGGTTCAAACTTCCTCCCATAGG - Intergenic
1098218416 12:68243581-68243603 TGGTTACAAAGTCCCTCCTTGGG - Intergenic
1101474423 12:105031065-105031087 TGGTTAATCATTGCTTCCTTTGG + Intronic
1102344782 12:112152601-112152623 TGGTTCAAAGATTGTTCCTTTGG + Intronic
1104696326 12:130866822-130866844 TGTTTAAAAGTATCTTCCCTTGG - Intergenic
1107049592 13:36032853-36032875 TGTCTAAAAGTTCCTTGCATGGG + Intronic
1107059051 13:36135944-36135966 TGCTTAAATGTTACTTCCTCGGG - Intergenic
1107242274 13:38250782-38250804 TTGATAAAAAGTCCTTCCTTTGG - Intergenic
1107855153 13:44607895-44607917 TTGTTACAAATTCATTCCTTTGG + Intergenic
1110302760 13:73948557-73948579 TGGTTAAAAGTAACATCCTGTGG + Intronic
1111825181 13:93258635-93258657 TGGTTAAAAATTACCTCCATGGG + Intronic
1111898389 13:94170024-94170046 TGATTAAAAGAGCTTTCCTTTGG + Intronic
1114721408 14:24886257-24886279 TGGTTAAAAACACCTTGCTTTGG + Intronic
1115675653 14:35670462-35670484 TGGTTACTCATTCCTTCCTTAGG + Intronic
1116649365 14:47569547-47569569 TGGTGTATAGTTTCTTCCTTTGG - Intronic
1116957523 14:50940096-50940118 TGGATAAAAGTACCTTCTCTGGG + Intronic
1117023367 14:51594911-51594933 TGGATATTCGTTCCTTCCTTTGG + Intronic
1117158065 14:52960475-52960497 TGTTTAAAAGATTCTTCATTGGG + Intergenic
1117598368 14:57346810-57346832 TGGTTGAAAGATCCTTCTTTTGG + Intergenic
1117632242 14:57705985-57706007 TAGTTAAAGGTGCCTTCTTTTGG - Intronic
1118300377 14:64609935-64609957 TGGTTTCAAGTTGCTTGCTTAGG + Intergenic
1118458901 14:65970364-65970386 TGGTTAAAATTTCTTTTCTTTGG + Intronic
1118710450 14:68514527-68514549 TGGCTAAAAGTTCCTCCTGTGGG + Intronic
1122402897 14:101477744-101477766 TGGTGGAAACTTCCTTTCTTTGG - Intergenic
1124039614 15:26088695-26088717 TGTTTAAAAATTCCTCCTTTTGG + Intergenic
1124052073 15:26206086-26206108 TGTTTAACAATTTCTTCCTTTGG + Intergenic
1124660142 15:31541299-31541321 TTTTTAAAAGTTGCTTTCTTTGG - Intronic
1124815529 15:32987952-32987974 TGTTTTAAAGTTCTTTGCTTTGG + Intronic
1126709546 15:51441830-51441852 GGTTTAAATGTTCCTTCCATGGG + Intergenic
1126737910 15:51750948-51750970 TCAGTGAAAGTTCCTTCCTTGGG - Intronic
1127566464 15:60194013-60194035 TGCTTAAAACTTACTTCCTTTGG - Intergenic
1128477494 15:68009715-68009737 GGGTTATAAGATCCTTCCTTGGG - Intergenic
1132194894 15:99907133-99907155 TAGATAAAAGTCACTTCCTTGGG + Intergenic
1133715939 16:8448769-8448791 TGGTTAAAAGCACCAACCTTTGG - Intergenic
1136734303 16:32449823-32449845 TGGCTAAAAGTTCCCACCATGGG - Intergenic
1138211119 16:55164169-55164191 TGGCCAAAATTTCCTTCTTTAGG - Intergenic
1143790345 17:9290144-9290166 GAGTTGAAAGTACCTTCCTTTGG + Intronic
1144157737 17:12523229-12523251 TGGTTAGAATGTCCTGCCTTGGG - Intergenic
1146383450 17:32348674-32348696 TGGTTAAAAGTCCAGTGCTTGGG - Intronic
1147720275 17:42535770-42535792 AGATTAAAAGTCACTTCCTTTGG + Intergenic
1148192731 17:45691122-45691144 GGGTTAATCGTTCCTTCATTTGG + Intergenic
1149189896 17:54049138-54049160 TGGTTAAATGTCATTTCCTTAGG + Intergenic
1150009805 17:61493150-61493172 TGGTCAAAATATGCTTCCTTGGG + Intergenic
1150508313 17:65721716-65721738 TGATCAACAGTTCCTTCCTTTGG + Intronic
1153056729 18:953057-953079 CTGTTAAAATTTCCTGCCTTTGG - Intergenic
1153134627 18:1900930-1900952 TGGCAAAATCTTCCTTCCTTTGG - Intergenic
1157304435 18:46506977-46506999 TGATTAGAAGATCCTTCCTCTGG + Intronic
1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG + Intronic
1157769649 18:50334663-50334685 TGGTTACAAGGTCCCTCCTCAGG - Intergenic
1158457303 18:57619531-57619553 TGGTTAAAAGTTCCTTCCTTGGG - Intronic
1158707834 18:59809670-59809692 TGGTTAGAAGTTCAGTCTTTAGG + Intergenic
1158755527 18:60320217-60320239 TGGTTAAAAAATCATTGCTTGGG + Intergenic
1159282229 18:66301132-66301154 TTGGTAAAAATTCCTTCCTTAGG - Intergenic
926244397 2:11112567-11112589 TGGAGAAAAGTTGCCTCCTTAGG + Intergenic
927310826 2:21629482-21629504 TAGATAAAAGTTCCTGCCTCTGG - Intergenic
928509029 2:31984355-31984377 TTGTGAAATGTTCCTTCATTTGG - Intronic
928615166 2:33031052-33031074 TGCATAAAAGTACCTTCCCTTGG - Intronic
929493755 2:42421391-42421413 AGTTTAAACGTTCCTTTCTTGGG - Intronic
930483341 2:51978136-51978158 TGGCTCAAAGTTCCTCCCATTGG - Intergenic
933572488 2:84029713-84029735 TGGTTAAGAGTTCATCCTTTAGG + Intergenic
934623889 2:95832872-95832894 TGGCTAAAAGGACCTTCATTGGG + Intergenic
937706847 2:124931005-124931027 TGGAGAAAGGGTCCTTCCTTTGG - Intergenic
939136046 2:138295266-138295288 ATGTTAAAAGTTCTTTTCTTAGG + Intergenic
939574190 2:143876382-143876404 TTCTTAAAACTTCCTTTCTTAGG + Intergenic
941107940 2:161381527-161381549 TGCTTAAAAATAGCTTCCTTCGG + Intronic
941635524 2:167931515-167931537 TGGTTAAGACTTCATGCCTTTGG + Intergenic
942304332 2:174590741-174590763 TTCTTAAAAGTTCATTGCTTGGG - Intronic
944212168 2:197217902-197217924 TGGCTGAATGTTCTTTCCTTGGG - Intronic
944720258 2:202416720-202416742 TGTTTAAAAGTTGCTTCTTATGG + Intronic
945215882 2:207433622-207433644 TGGATAAAAATTCCATCATTTGG - Intergenic
946970440 2:225084776-225084798 TGGTTAAAAGAGCCTGCCTCTGG - Intergenic
947289498 2:228556463-228556485 TGTTCAACAGTTCCTTCCATTGG + Intergenic
947488873 2:230576802-230576824 TGGTTCAAACTCCCTACCTTGGG - Intergenic
1168927430 20:1594297-1594319 TCCTTGACAGTTCCTTCCTTGGG - Intronic
1171028551 20:21654880-21654902 TGGTTTATAGCTACTTCCTTGGG - Intergenic
1171233104 20:23503191-23503213 TGGGTAAATTTTCATTCCTTTGG - Intergenic
1172214181 20:33223344-33223366 GCTTTAAAAATTCCTTCCTTTGG + Intronic
1172398152 20:34624659-34624681 TAATTAAAAACTCCTTCCTTGGG - Intronic
1172541163 20:35718157-35718179 ACATTAAAAGTTCGTTCCTTGGG - Intronic
1174535871 20:51251193-51251215 TGATTAAAATTTCCATCTTTGGG - Intergenic
1175967887 20:62668770-62668792 GGCTTAAACGTTCCTTTCTTTGG - Intronic
1176046584 20:63096167-63096189 AGTTTAGAAGTTCCTTCCTGGGG + Intergenic
1177132865 21:17279036-17279058 TGGTTAAATGTTCCCTTCCTGGG - Intergenic
1177868286 21:26539197-26539219 TGGTTAAAAATTCCTGCTGTAGG + Intronic
1180077440 21:45469839-45469861 GGGTTAAAAGTTCCTGCCAAAGG - Intronic
1181393456 22:22600690-22600712 TGGATAAGAGTTTCTTCCATGGG + Intergenic
1181421303 22:22800893-22800915 TGGATAAGAGTTGCTTCCATGGG + Intronic
1181696284 22:24594445-24594467 AGATTCAAGGTTCCTTCCTTTGG + Intronic
1182773996 22:32817644-32817666 AGATTTAAAGTTCCTTCCTGTGG + Intronic
949852962 3:8437330-8437352 TCATTAAAAATTCATTCCTTTGG + Intergenic
950348560 3:12323451-12323473 TTCTTAAAAGTCCCCTCCTTTGG - Intronic
951404477 3:22278781-22278803 TGGTTAAGAATTCCTTCTCTTGG + Intronic
953206183 3:40831637-40831659 TAGTTAAAAGTACGATCCTTTGG - Intergenic
954730673 3:52658690-52658712 TGCTTAGAAGTTGCTTTCTTTGG - Intronic
958784830 3:98586415-98586437 TTGTTTATAGTACCTTCCTTTGG - Intronic
960215982 3:115037583-115037605 TAGTTAAAAATTCTTTACTTGGG - Intronic
960705225 3:120475117-120475139 TGCTTATAAGATACTTCCTTTGG - Intergenic
960740048 3:120823438-120823460 TGCTGAGAATTTCCTTCCTTGGG + Intergenic
960942986 3:122946658-122946680 TGGTTAAAAGTCACTGCCTTTGG - Intronic
961152386 3:124650196-124650218 TCGTTAACAGTTCCATCCATGGG + Intronic
961269328 3:125676989-125677011 TGGTTAAAAGTCCCTATCATGGG + Intergenic
962182974 3:133227491-133227513 TGGTTAGAAAGGCCTTCCTTAGG - Intronic
963152734 3:142063552-142063574 TTGTTGAAAGTTATTTCCTTAGG + Intronic
963345051 3:144085983-144086005 TTCTTAAAAGTTGCTTTCTTGGG + Intergenic
963624479 3:147653790-147653812 TGGTTACAAATAGCTTCCTTAGG + Intergenic
964959489 3:162405608-162405630 AGGTTAAATGTTTCATCCTTGGG - Intergenic
969352939 4:6608650-6608672 GGGTTAACAGTCCCTGCCTTTGG + Intronic
969471930 4:7394211-7394233 TGCATAAACGATCCTTCCTTTGG + Intronic
971650815 4:29270858-29270880 TGTTTAAAACTTCCTCCTTTTGG - Intergenic
971881663 4:32382489-32382511 CGGGTAAAAATTCCTTCTTTAGG + Intergenic
972883426 4:43454799-43454821 GGGTTAAAAGTTTCTTCTTTTGG + Intergenic
973130591 4:46643330-46643352 TGGCTAAAAGTTCCTAGATTTGG - Intergenic
973617496 4:52693322-52693344 TGGTTGAAAATTCTTTTCTTTGG - Intergenic
973741186 4:53921002-53921024 TGGTTAAAAGTTCAGGCTTTAGG + Intronic
974590392 4:63941582-63941604 AAGTTAAAAGTTACTTTCTTTGG - Intergenic
975452292 4:74543210-74543232 TGGTAAGAAATTACTTCCTTAGG - Intergenic
976336803 4:83897563-83897585 TGGTCAAAAATTTCTTTCTTGGG + Intergenic
977733826 4:100387080-100387102 TGGTTAAAAGTTCTTATCTCTGG - Intergenic
978015513 4:103740246-103740268 TGTTTAACAATTGCTTCCTTTGG - Intergenic
978557745 4:109998821-109998843 TTATTAAAAATTCCTCCCTTTGG - Intronic
979249839 4:118555065-118555087 AGGTTAAAATTTTCTTCATTAGG + Intergenic
982303920 4:153908826-153908848 TGGTTAAAAATTCTTTCCAAAGG + Intergenic
982510542 4:156276832-156276854 ATGTTGCAAGTTCCTTCCTTAGG - Intergenic
982523247 4:156446660-156446682 TTTTTAAAAATTGCTTCCTTTGG - Intergenic
985533309 5:446546-446568 TGTTTAAAAGCTTGTTCCTTTGG - Intronic
986997136 5:13620287-13620309 TGGTCCAAAGCACCTTCCTTTGG + Intergenic
987444796 5:18004496-18004518 TGGTTGGAAGTTCCTTGATTAGG + Intergenic
987673007 5:21037464-21037486 TGCTGGAAAGTTCCTTCATTAGG - Intergenic
987817622 5:22923368-22923390 TGCTTAAAAATTACTTCCTAAGG + Intergenic
991373723 5:65943642-65943664 TGTTTAAAATTTCCCTTCTTTGG + Intronic
995006841 5:107208019-107208041 TCATTAAAAGTTCCTTACTGGGG - Intergenic
996670521 5:126112736-126112758 TGCTTAGAAATTTCTTCCTTTGG - Intergenic
999091170 5:148937286-148937308 TGGTTAAAAGTACAGGCCTTGGG - Intronic
1001187156 5:169585146-169585168 TGCTGAAAAGTTACTTCCTCAGG + Intronic
1001777645 5:174340775-174340797 AGTTCAAATGTTCCTTCCTTGGG + Intergenic
1006957757 6:37891113-37891135 TGTCTAAAATTTCCTTCTTTGGG + Intronic
1007503992 6:42320310-42320332 GGATTAAAAGTTCCTACTTTAGG + Intronic
1008325428 6:50175088-50175110 TGGGTAGAACTTCCTTCCTTGGG - Intergenic
1009978772 6:70701574-70701596 GGTATAAAAGTTCCTTCCTTGGG + Intronic
1010044544 6:71425891-71425913 TGGTTAAAAGGGTTTTCCTTTGG + Intergenic
1010107735 6:72188996-72189018 TGGTGACAGGTTCCTTCCTCTGG + Intronic
1012049838 6:94327987-94328009 TGGTTTAATGCTCCTTCCATAGG - Intergenic
1012442610 6:99275554-99275576 TGGGGACAAGTTCCTTGCTTCGG + Exonic
1013162979 6:107563953-107563975 TGGATACTAGTTCCTGCCTTTGG - Intronic
1016471577 6:144380389-144380411 TGGTTTAAGTTTCCTTCCTTTGG + Intronic
1016639658 6:146334232-146334254 TGGGTAAAAGTTTCTGCCTCTGG + Intronic
1017391730 6:153947160-153947182 TGGTTAAAAGCTACTTGCTGTGG - Intergenic
1019489272 7:1303904-1303926 TGATTCAAAGTTCCTCCCCTAGG + Intergenic
1020156398 7:5728184-5728206 TGATTAAATGTCCCTTCCTCAGG + Intronic
1020610435 7:10389950-10389972 TGGTTAAATGTTAATCCCTTTGG + Intergenic
1021353643 7:19627680-19627702 TGGTTAAATGCTCCTTCTGTGGG - Intergenic
1022025403 7:26443702-26443724 TGGTGGGAAGTTCCTTCCTCAGG + Intergenic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022951668 7:35344855-35344877 GTATCAAAAGTTCCTTCCTTGGG - Intergenic
1023569113 7:41554106-41554128 TGGTTTACAGCTACTTCCTTGGG + Intergenic
1023747175 7:43332343-43332365 GGGTTAACAGTCCCTTCCTTGGG - Intronic
1023748178 7:43342635-43342657 TGGTTAAAATTGCTTTTCTTGGG + Intronic
1026821879 7:73555510-73555532 AGCTCAAAAGTTGCTTCCTTAGG - Intronic
1030899157 7:115100938-115100960 CTGATAAAAGTTCTTTCCTTTGG + Intergenic
1031158948 7:118143243-118143265 TGGAGAAAAGTTCCTTCATGGGG - Intergenic
1031174734 7:118336163-118336185 TTGTTATAAATTCATTCCTTTGG + Intergenic
1031913950 7:127545123-127545145 TGGTTAAAAGTTTGCTCCATGGG - Intergenic
1032243331 7:130184447-130184469 TCTTTAAAAGTTCCTTACATTGG + Intronic
1034653072 7:152707571-152707593 AAGTCAAAAGTTCCTTGCTTGGG - Intergenic
1034910702 7:154995957-154995979 TGTTTAAAACTTGCTTCTTTGGG - Intronic
1035706400 8:1678705-1678727 TGGAGAAAAGTTCCTCCCTTTGG + Intronic
1035746397 8:1964485-1964507 TTTTTAAAAGTTTCTTCTTTAGG + Intergenic
1037313792 8:17582234-17582256 TGATTAAAAATTTCTTCTTTAGG - Intronic
1038059021 8:23891822-23891844 TGATTTAAAGCTCCTTTCTTAGG - Intergenic
1038252139 8:25914856-25914878 TGGTAATAAGTCCCTGCCTTAGG - Intronic
1039116123 8:34093071-34093093 TCGTTCAAAGTTTCTTCCTGAGG - Intergenic
1042066581 8:64883836-64883858 TGGTTTGAAGGACCTTCCTTAGG - Intergenic
1042469437 8:69167251-69167273 TGTTTATATGTTCATTCCTTAGG + Intergenic
1043626475 8:82266995-82267017 TGGTTAAAAAATCCATCCCTGGG + Intergenic
1044025997 8:87173564-87173586 GGGTAAAAAGTTTTTTCCTTCGG + Intronic
1044841869 8:96343819-96343841 TTCTTAAAACTTCCTTCTTTGGG + Intergenic
1046820830 8:118632570-118632592 TGGTTAAAAGCTGCATCCTATGG - Intergenic
1048488274 8:134868488-134868510 TCTTTGAAATTTCCTTCCTTTGG + Intergenic
1048512444 8:135075024-135075046 TGGTTAAAAGTGACTGGCTTGGG + Intergenic
1048830998 8:138477408-138477430 GGGTGAAGAGCTCCTTCCTTTGG + Intronic
1049001612 8:139829005-139829027 TGCTTAAAAATTCCTACATTTGG + Intronic
1050173703 9:2848795-2848817 TTGATAAAAGTTATTTCCTTTGG + Intergenic
1054773456 9:69104388-69104410 TGATTAAAAATTCTTTCATTTGG - Intergenic
1055405947 9:75973884-75973906 TGGTGATAGGTACCTTCCTTGGG + Intronic
1058186859 9:101865388-101865410 TGGTTAAAAGATCTTTATTTAGG + Intergenic
1058301159 9:103374594-103374616 GAGTTAACAGTTCCTTCCATAGG - Intergenic
1058865103 9:109154741-109154763 TTGTTAAAACTTCCATCCTTGGG - Intronic
1061032776 9:128096610-128096632 TGGTTATAAGTTTGTTTCTTGGG + Intronic
1186759080 X:12704211-12704233 AAATTAAAAGTTACTTCCTTTGG + Intronic
1190443858 X:50503317-50503339 TGATTTAAAGCTTCTTCCTTAGG - Intergenic
1192726042 X:73753023-73753045 GGTTTAAATGTTCCTTCCATGGG + Intergenic
1193555855 X:82952595-82952617 AGTTTAAATGTTCCTTCCGTGGG + Intergenic
1193706312 X:84824142-84824164 TGGTTAGAAGTTTCTTCCATCGG + Intergenic
1194584944 X:95720295-95720317 TGGTATAAAGATCCTTCCTAGGG + Intergenic
1194839890 X:98727016-98727038 TGTTTAAATGCTCCTTCCATGGG + Intergenic
1195132007 X:101862462-101862484 TTGTTAACAGTTCCAGCCTTGGG + Intergenic
1196047557 X:111271986-111272008 TTGTTAAAAGGGTCTTCCTTAGG + Intergenic
1196895749 X:120334010-120334032 TGCCTAAAAGTTGCCTCCTTTGG + Intergenic
1197671792 X:129285125-129285147 TATTTAAAAATTCCTTCCATAGG + Intergenic
1198286829 X:135199461-135199483 TGGAGAAAATTTCCATCCTTGGG + Intergenic
1198304936 X:135371381-135371403 GGGTGAACAGTTCCTTCTTTTGG + Intergenic
1198956609 X:142138245-142138267 AGGGTAAAAGTTCTTTTCTTTGG - Intergenic
1201166128 Y:11210417-11210439 TGCTTAAAAATTCCTCCTTTTGG - Intergenic
1202203093 Y:22375269-22375291 TAGGTAAAAGTTCCTTCTTATGG + Intronic