ID: 1158461902

View in Genome Browser
Species Human (GRCh38)
Location 18:57653848-57653870
Sequence ATTCTGTTGTCAGGCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158461902 Original CRISPR ATTCTGTTGTCAGGCATCAA GGG (reversed) Intronic
904478046 1:30777183-30777205 ACTCTGGTGTCAGGCATCCTGGG - Intergenic
905750043 1:40454261-40454283 ATTCTGCTGTCAGGGATCCAAGG - Exonic
905876757 1:41436351-41436373 ATTCTGTTCTCTGGCACCAGTGG - Intergenic
906387683 1:45385748-45385770 ATTCTGTTGCCTGGGAACAATGG - Intronic
906837830 1:49102981-49103003 ATTCTGTTATGAGGCATCTGTGG + Intronic
909233455 1:73120819-73120841 CTTCCGTAGTCAGGAATCAAGGG + Intergenic
909900194 1:81124873-81124895 ATTCAAATGTCAGGCATCAATGG + Intergenic
910386541 1:86689492-86689514 ATACTGTTGTCAAGCAACAAGGG + Intergenic
911592098 1:99760146-99760168 TTGCTGTTTTCAGGCATCTATGG - Intronic
912442836 1:109712273-109712295 ATTCTGCAGACAGGCATCAGCGG - Exonic
915732125 1:158061147-158061169 ATTCTGATATCAGGAAGCAAAGG + Intronic
917012231 1:170487866-170487888 ATTCTATTGTTAGGCATTTAGGG + Intergenic
918962946 1:191303596-191303618 ATTCAGATGTCAGGGATGAATGG - Intergenic
920266542 1:204728057-204728079 ATTCTGATGACAGTCCTCAAAGG - Intergenic
920616837 1:207501799-207501821 CTTCCTTTGTCCGGCATCAATGG + Intronic
920948825 1:210554010-210554032 TTTCTGTTGTCATACATCATGGG + Intronic
922673840 1:227538176-227538198 ATTCTGTTGTCCAGCATTTATGG - Intergenic
923678965 1:236103598-236103620 AATCTGCTGTCAGGCAAAAATGG - Intergenic
1064735856 10:18381163-18381185 GTTCTGTTGTCAGTAATCACAGG + Intronic
1071199938 10:83209910-83209932 ATTCTGTCTTCAGGCAGAAAAGG + Intergenic
1072533389 10:96340484-96340506 ATTCTTCTGTCAGCCATCAGAGG - Intergenic
1073223850 10:101899584-101899606 CTTCTGTTAACAGGCATCAAGGG - Intronic
1073243573 10:102074026-102074048 ATTCTGGTGACAGGCCCCAAAGG - Intergenic
1075427716 10:122354817-122354839 ATTCTGTTGTCAGTTTTGAAAGG + Intergenic
1075733876 10:124652398-124652420 ATGCTGTTGTCAGGTGTCAGAGG + Intronic
1076945525 10:133646507-133646529 ATTTTGTTGTCAGGCCAGAACGG + Intergenic
1079850052 11:25521312-25521334 ATTCAAATGTCAGGCATAAATGG - Intergenic
1080258253 11:30317604-30317626 ATTCTGTTGTCTGCCTTCACTGG + Intergenic
1082942052 11:58716475-58716497 ATTCTGTTTTCAGCCATGAGTGG + Intronic
1084281772 11:68100882-68100904 ATTCTGTTTTAAGGAATCATGGG - Intronic
1087118756 11:94550938-94550960 AATCTGTTGTCATGAATCAAGGG - Intronic
1087332920 11:96805534-96805556 ATTCTGTTTACAGGCATTAAGGG + Intergenic
1089044297 11:115486074-115486096 ATTCTCTAGTCAGCCATCAATGG + Intronic
1089141254 11:116286336-116286358 ATCATCTTGCCAGGCATCAATGG - Intergenic
1089451982 11:118605277-118605299 ATCCTGAAGTCAGGCATCATTGG - Intergenic
1090981262 11:131724680-131724702 TTTCTTTTCTCAGGCATCACTGG - Intronic
1092020721 12:5200264-5200286 ATTCTGATGTCAGTCCTGAAAGG + Intergenic
1092271010 12:7023365-7023387 AGTCTCTTATCAGGCATAAAAGG - Intronic
1093392917 12:18644471-18644493 ATTCTGTTGTAAGGTGTAAAGGG + Intronic
1093916414 12:24807154-24807176 AGTGTATTTTCAGGCATCAATGG - Intergenic
1095246327 12:39927278-39927300 ATTTTGGTGTCAGGAATCAAAGG - Intronic
1096741829 12:53699124-53699146 AGGTTGTTGTGAGGCATCAATGG - Intergenic
1097436469 12:59556241-59556263 ATGATGTTTTCAGGCATTAAAGG - Intergenic
1099907317 12:88787449-88787471 TGTCTGCTGTCAGGCAACAATGG + Intergenic
1101667375 12:106831614-106831636 ATCCAGATGTCAGGCTTCAATGG - Intronic
1103562385 12:121799635-121799657 CTTCTGTTGTCAGGCATTTGGGG - Intronic
1107976618 13:45694410-45694432 ATTCTGTTTTCAGGCAGTATGGG + Intergenic
1108463156 13:50687770-50687792 TGTCTGATGTCAGGAATCAATGG + Intronic
1114030965 14:18580921-18580943 ATTCTGTTGTCCAGCATTTATGG - Intergenic
1115102870 14:29724010-29724032 ATGCTGTTCTCATGCAGCAAGGG + Intronic
1115207460 14:30925027-30925049 ATTTTGGTCTCAGGCTTCAAAGG - Intronic
1117156179 14:52944366-52944388 ATTCAGTTGTGAGCCCTCAAGGG + Intronic
1202919547 14_KI270723v1_random:18310-18332 ATTTTGTTGTCAGGCCAGAACGG + Intergenic
1123475919 15:20592594-20592616 ACTCTGTGGTCAGGAATCACAGG - Intergenic
1123642092 15:22407769-22407791 ACTCTGTGGTCAGGAATCACAGG + Intergenic
1124151629 15:27184352-27184374 ATCCTGTTTTCAGGCAAAAAGGG + Intronic
1124175614 15:27421558-27421580 ATACTGTTTTAAGGCATCCATGG + Intronic
1128671918 15:69580144-69580166 CATCTGTTGTCTGGCAGCAACGG + Intergenic
1131091528 15:89628129-89628151 ATTCTGGTTTCAGGCGTAAATGG - Exonic
1133136172 16:3713691-3713713 ATTCTGTGGTCAGGCAGGTACGG - Intronic
1139337341 16:66242033-66242055 ATTCTGCTGTCAGGGGTCATGGG - Intergenic
1142516287 17:431659-431681 ATGATGCTGACAGGCATCAAAGG - Intergenic
1148530389 17:48384717-48384739 ATTCTGTTGTCAAGGAAGAAGGG + Intronic
1149087384 17:52734370-52734392 TTTCTTTTGTCAGGCCTAAAGGG + Intergenic
1150954731 17:69844739-69844761 ATTCTGTAGTCAGATTTCAAAGG - Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153450198 18:5218635-5218657 ACTCTGTGGTAAGGCATCAAAGG - Intergenic
1155793499 18:30004149-30004171 CTTCTCTTGACAGGAATCAAAGG - Intergenic
1156689714 18:39692857-39692879 ATTCTGCTGTCAGACACCATGGG + Intergenic
1158461902 18:57653848-57653870 ATTCTGTTGTCAGGCATCAAGGG - Intronic
1163791842 19:19311198-19311220 ATTTTTTTGACAGGCATGAAGGG + Intronic
1165767714 19:38361448-38361470 ACTCTGGTCTCAGGGATCAAGGG + Intronic
927322108 2:21758880-21758902 ATTCTGTGGTCAGCCATCCATGG - Intergenic
927474154 2:23399759-23399781 TTTCTGATGTCAGTCATCATGGG + Intronic
927679059 2:25128184-25128206 ATTCGAATGTCAGGCATCAAAGG + Exonic
929916336 2:46139041-46139063 ATCCAGGTGTCAGGCAACAAGGG + Intronic
931160443 2:59684392-59684414 CCTCTGCTGTCAGGCAGCAATGG + Intergenic
935505825 2:103901302-103901324 TTTCTGTTGTCGGGCATTACTGG + Intergenic
936402219 2:112174021-112174043 CTTCTTTTGGCAGGCAGCAAAGG + Intronic
938497238 2:131804853-131804875 ATTCTGTTGTCCAGCATTTATGG + Intergenic
940189070 2:151019368-151019390 ATTCTGTTTTCTGGCTTCCATGG - Intronic
942422958 2:175826987-175827009 CTTCTGTGGTTAGGCAACAAAGG - Intergenic
943673781 2:190696301-190696323 ATTATGTTGTCAGGGATCTGGGG - Intergenic
945235705 2:207629531-207629553 ATTTTGCAGTCAGGCATCATAGG - Intergenic
948647193 2:239412861-239412883 CTCCTGTTTTCAGGAATCAATGG - Intergenic
1169014481 20:2280437-2280459 ATTCTGTGGTCAGGCACCTCAGG + Intergenic
1170346198 20:15389468-15389490 ATTCTGGCATCAGGCTTCAACGG - Intronic
1170595565 20:17803057-17803079 ATTCTGTTTTCAAGCCACAAAGG - Intergenic
1171202785 20:23255351-23255373 AGCCTGTTCTCAGGCATCACTGG - Intergenic
1171783512 20:29442601-29442623 ATTTTGTTGTCAGGCCAGAAAGG + Intergenic
1172501810 20:35433085-35433107 ATTCTGCTGCCAGGCCCCAATGG + Exonic
1178633622 21:34283454-34283476 ATGCTGTTGTCAGGCAGCCCCGG + Intergenic
1180455078 22:15507979-15508001 ATTCTGTTGTCCAGCATTTATGG - Intergenic
1181132700 22:20742730-20742752 ATTCGGTTCTCAGGCACCACAGG - Exonic
1184320470 22:43738880-43738902 GTCCTGTTGTAAGGGATCAAGGG + Intronic
952964564 3:38613178-38613200 AATCTGTGGACAGGCATCATCGG - Intronic
957081959 3:75643961-75643983 ATTTTGTTGTCAGGCCAGAAAGG - Intergenic
957108579 3:75924169-75924191 AATATGTTGTCAGGCAGCATGGG + Intronic
958121849 3:89300664-89300686 ACTCTGAAGTCAGACATCAAAGG - Intronic
958427404 3:93994894-93994916 ATTCTGTTTTCAGCCCTCCATGG + Intronic
958662589 3:97090125-97090147 ATTCTGTTTTCTAGCATGAAGGG - Intronic
959399918 3:105887236-105887258 TTTGTATTGTCAAGCATCAAAGG + Intergenic
960186641 3:114649220-114649242 ATTTTGTATTCAGGCAGCAAGGG - Intronic
960747968 3:120909808-120909830 ATACTGTTGTAAGGAAACAAGGG + Intronic
962510098 3:136090271-136090293 ATACTCATGTTAGGCATCAATGG - Intronic
966630228 3:182065021-182065043 GTTCTGTTGAGAGACATCAATGG + Intergenic
969169772 4:5351258-5351280 AATGTTTTCTCAGGCATCAATGG + Intronic
971959812 4:33471258-33471280 AAGCTCTTGTCAGGCATCCAAGG + Intergenic
972912866 4:43839992-43840014 AATCTGCTGTCAGGCTGCAATGG - Intergenic
974387987 4:61227716-61227738 ATTCTTTTGTCAAAAATCAAAGG + Intronic
975156671 4:71080112-71080134 ATCCTGTTGCCAGGAATCGAAGG + Intergenic
976080010 4:81345524-81345546 ACACTGTGGTCAGGAATCAAAGG - Intergenic
980869577 4:138595320-138595342 TTAGTGTTGTCATGCATCAAAGG + Intergenic
985268117 4:188168845-188168867 TTTCAGTTGTCAGGCATCTCTGG - Intergenic
985448911 4:190047019-190047041 ATTTTGTTGTCAGGCCAGAACGG + Intergenic
986134456 5:4961206-4961228 AGTATGTTCTCAGGCAACAATGG + Intergenic
987004329 5:13694105-13694127 ATTCAGATGTAAGGCACCAAAGG - Intronic
987285092 5:16448324-16448346 AGTCTGTAGACAGGCAGCAAAGG + Intergenic
989476053 5:41874191-41874213 ATTCTGTGGTTAGGCTTCTAGGG + Intergenic
992904241 5:81330175-81330197 ATTCTGTTGTAAGTCATCTGTGG - Exonic
993523070 5:88928726-88928748 ATACTGGTGTCAGGCATCCAAGG + Intergenic
997951244 5:138244193-138244215 ATACTGGAGTCGGGCATCAAAGG - Intergenic
1001725261 5:173891130-173891152 ATTCTCATGTCAGGCAAGAAAGG - Intronic
1002896005 6:1380724-1380746 ATTATGTTGTCGGGCATATATGG + Intergenic
1003895313 6:10601978-10602000 ATCCAGTTTTCCGGCATCAAGGG - Intronic
1004706184 6:18125795-18125817 ATCCTTTTCTCAGGCATCACAGG - Intergenic
1006581525 6:35080353-35080375 TTTCTGTTGTCAGGAATTACCGG - Intronic
1007147729 6:39653549-39653571 TTTTAGATGTCAGGCATCAAAGG - Intronic
1007564429 6:42838563-42838585 ATTCAGGTGAGAGGCATCAAAGG - Intronic
1007705394 6:43787690-43787712 ATACTGTTGCCAGGCACCTATGG - Intergenic
1008199870 6:48573045-48573067 ACTCTGTGCCCAGGCATCAAGGG - Intergenic
1013087323 6:106867424-106867446 ATTCTGTTGAGAGGCAGTAAAGG + Intergenic
1013532892 6:111036243-111036265 ATTCTATTGTTGGGCATTAATGG + Intergenic
1016531036 6:145058409-145058431 ATTCTATTGTCTGGCATTACTGG - Intergenic
1017009198 6:150051606-150051628 AGTCAGTTGTCGGGCATCAGAGG + Intergenic
1022211329 7:28212975-28212997 ATTCTCTTATCAGGCAGCAAAGG + Intergenic
1022516566 7:30978444-30978466 TTTCTGTTGTCAGGCAGCTGTGG + Intronic
1028887327 7:95948543-95948565 TTTCTGTTCTAAGGAATCAAAGG - Intronic
1039727541 8:40235443-40235465 ATTCTGTTGGCAGCCAGTAAAGG + Intergenic
1042334840 8:67619403-67619425 ATTCTCTCTTCAGGTATCAATGG + Intronic
1043771962 8:84214781-84214803 ACTCTGTTGTTTGGCATAAATGG - Intronic
1046557037 8:115787651-115787673 ATTCTGTTTTCAGCCATAATGGG - Intronic
1046743497 8:117852791-117852813 ATTCTATTGTCAGGATACAATGG + Intronic
1048100817 8:131349375-131349397 ATTCTGTTGGCAGGGATCTCTGG - Intergenic
1048263653 8:132966733-132966755 ACACTGTAGTCAGGCATCACAGG + Intronic
1048951202 8:139498346-139498368 ATTCTGATGTCGGGCATTAGGGG + Intergenic
1056303642 9:85268272-85268294 ATTTTGCTGTCAGGCTTAAATGG + Intergenic
1060001986 9:119967164-119967186 ATTCTGTTGTTATGAAACAAGGG - Intergenic
1060734300 9:126056632-126056654 ATTCTGGAGTCAGGCTTTAAGGG + Intergenic
1187930905 X:24292790-24292812 ACTCTGTTGTCAGGAAGCAGAGG - Intergenic
1187975134 X:24697302-24697324 CTACAGATGTCAGGCATCAAGGG + Intronic
1189064801 X:37795981-37796003 ACCCTGTTGGCAGGCATCACTGG + Exonic
1192938139 X:75882695-75882717 ATCCTGTTTTCAGGCATAAGTGG + Intergenic
1194696275 X:97055133-97055155 ATTCTGTTGTCTGGGCTCAAAGG + Intronic
1200298535 X:154947898-154947920 ATTGTTTTTGCAGGCATCAATGG - Exonic