ID: 1158465432

View in Genome Browser
Species Human (GRCh38)
Location 18:57685955-57685977
Sequence ACACAATTGTAGGCCGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1552
Summary {0: 1, 1: 0, 2: 11, 3: 161, 4: 1379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158465427_1158465432 29 Left 1158465427 18:57685903-57685925 CCTGGGCGACAGAGTGAGACTCT 0: 4925
1: 39417
2: 119577
3: 170658
4: 174535
Right 1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG 0: 1
1: 0
2: 11
3: 161
4: 1379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158465432 Original CRISPR ACACAATTGTAGGCCGGGTG TGG Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
900292967 1:1932104-1932126 AGAAAAATGTAGGCCGGGCGCGG + Intronic
900388839 1:2424695-2424717 ACACAAAATTAGGCCGGGCGCGG + Intergenic
900669724 1:3843640-3843662 TAACAATTGTAGGCTGGGTGTGG - Intronic
901382221 1:8882050-8882072 AAAGAAATGGAGGCCGGGTGCGG + Intergenic
901532149 1:9860298-9860320 CCAGGATTCTAGGCCGGGTGTGG + Intronic
901542418 1:9928000-9928022 AAACAAACGTAGGCTGGGTGTGG + Intronic
901579870 1:10233323-10233345 AAACATTTGAAGGCCGGGTGTGG + Intronic
901583457 1:10265552-10265574 ACACAAATTAAGGCCAGGTGCGG + Intronic
901977759 1:13008948-13008970 ATATATTTCTAGGCCGGGTGTGG + Intronic
902004326 1:13219987-13220009 ATATATTTCTAGGCCGGGTGTGG - Intergenic
902023546 1:13365725-13365747 ATATATTTCTAGGCCGGGTGTGG - Intergenic
902056127 1:13601946-13601968 AGAAAGATGTAGGCCGGGTGCGG + Intronic
902452048 1:16502542-16502564 AAAAACTTGTAGGCCGGTTGTGG + Intergenic
902455559 1:16531335-16531357 AAAAACTTGTTGGCCGGGTGCGG - Intergenic
902496619 1:16876560-16876582 AAAAACTTGTTGGCCGGGTGCGG + Intronic
902515893 1:16989499-16989521 TAATAATTGTAGGCTGGGTGCGG - Intronic
903119268 1:21204227-21204249 ATACAATTTTTGGCCTGGTGTGG + Intergenic
903199312 1:21720819-21720841 AAACAATTTTAGTCTGGGTGCGG - Intronic
903386793 1:22932270-22932292 ATTAAATTCTAGGCCGGGTGCGG - Intergenic
903490713 1:23726109-23726131 AAAAAATTTTAGGCCAGGTGCGG - Intergenic
903609371 1:24598987-24599009 CTAAAATTGGAGGCCGGGTGTGG + Intronic
903785799 1:25860444-25860466 ACAAAATTTTTGGCCGGGCGCGG - Intergenic
903900053 1:26637664-26637686 TAACAATGATAGGCCGGGTGTGG - Intergenic
903901979 1:26653551-26653573 AGAAAATTATAGGCTGGGTGCGG - Intergenic
903903837 1:26669011-26669033 AGAAAACTGTAGGCCAGGTGCGG - Intergenic
903927800 1:26843296-26843318 ACACAAAAGTTAGCCGGGTGTGG - Intronic
903949771 1:26989559-26989581 ACACAAGGGTAGGCCGGGTGCGG - Intergenic
904166969 1:28563257-28563279 TAACAAAGGTAGGCCGGGTGCGG + Intronic
904526524 1:31137729-31137751 AAACAATAATAGGCCGGGTATGG + Intergenic
904565851 1:31428015-31428037 AAAAAATTTTAGGCTGGGTGTGG - Intronic
904749792 1:32734481-32734503 ATACATATGTAGGCCGGGCGCGG + Intergenic
905015535 1:34775890-34775912 AAAAAATTGTTGGCTGGGTGCGG - Intronic
905163330 1:36057028-36057050 AAAGAATAGTAGGCCGGGTGCGG - Exonic
905368361 1:37468310-37468332 ACAAAATTCAAGGCCAGGTGTGG + Intergenic
905438053 1:37972888-37972910 ACTTAAATGTGGGCCGGGTGCGG + Intronic
905569866 1:38994978-38995000 AAAAATTAGTAGGCCGGGTGTGG - Intronic
905583583 1:39100561-39100583 TCAAAAATTTAGGCCGGGTGCGG + Intronic
905613612 1:39377300-39377322 ACAAAATAGTTGGCCGGGCGCGG - Intronic
905672494 1:39801194-39801216 ACAAAATTATAGGCTGGGCGCGG + Intergenic
905686941 1:39915015-39915037 AAATAATAATAGGCCGGGTGTGG - Intergenic
905709485 1:40088994-40089016 TCTCATTTGAAGGCCGGGTGTGG + Intronic
905930935 1:41787040-41787062 TTACATATGTAGGCCGGGTGTGG - Intronic
906017412 1:42594216-42594238 ACTTAATTATAGGCCAGGTGTGG + Intronic
906067965 1:42995829-42995851 TAAACATTGTAGGCCGGGTGCGG - Intergenic
906342037 1:44988792-44988814 AAACAATAATAGGCCAGGTGCGG + Intergenic
906420509 1:45662759-45662781 AAAGAATATTAGGCCGGGTGCGG + Intronic
906493021 1:46282738-46282760 ATACAACTATAGGCCAGGTGTGG + Intronic
906838794 1:49113238-49113260 AAAAAATTTAAGGCCGGGTGCGG - Intronic
907198424 1:52705856-52705878 TAATAATTTTAGGCCGGGTGCGG - Intergenic
907947087 1:59145706-59145728 ACAATGTTATAGGCCGGGTGTGG - Intergenic
908135649 1:61129210-61129232 ACACATAAGTAGGCCGGGCGCGG - Intronic
908153482 1:61328707-61328729 AAAAAATTATAGGCCGGGTGCGG - Intronic
908203394 1:61820630-61820652 AAATAAATGTAGGCCGGGTGTGG - Intronic
908887859 1:68810671-68810693 ACACAGCTGTCGGCCGGGTGCGG - Intergenic
909002566 1:70236618-70236640 AAAAAATTGTAGGCCGGGCATGG - Intronic
909072658 1:71015188-71015210 ACACAATTGTAGGCCTTCAGAGG - Intronic
909602918 1:77479494-77479516 AGACAATTTCAGGCCGGGTACGG - Intronic
909627253 1:77731659-77731681 ACACTATTGGTGGCTGGGTGTGG - Intronic
909657965 1:78051783-78051805 TCACAATTCTACGCCAGGTGCGG - Intronic
910403149 1:86856940-86856962 AGAAAATTGTAGGCCGGGCACGG + Intergenic
910499226 1:87870590-87870612 AAATAATTGTCGGCCGGGCGCGG + Intergenic
910930693 1:92440265-92440287 AAAATATTGTAGGCTGGGTGTGG - Intergenic
910932358 1:92455071-92455093 TAAAAATTGCAGGCCGGGTGGGG - Intergenic
910959885 1:92750858-92750880 ACATATTTTTGGGCCGGGTGCGG + Intronic
911837660 1:102641839-102641861 ACATAATCCTAGGCCGGGTGCGG - Intergenic
912145995 1:106795186-106795208 AAATAAATGTAGGCCGGGTGTGG + Intergenic
912335750 1:108861111-108861133 ACATATTTGTAGGCCGGGCGTGG + Intronic
912597012 1:110889264-110889286 ACTCAATAATTGGCCGGGTGTGG + Intronic
912922223 1:113880334-113880356 ACAAGATTTTAGGCCGGGCGTGG + Intronic
913368429 1:118069053-118069075 ATATAAAAGTAGGCCGGGTGTGG + Intronic
913676946 1:121149851-121149873 AAAGAATTGGAGGCCGGGCGCGG + Intergenic
914193755 1:145432736-145432758 ACAAAATAGAAGGCCGGGCGCGG - Intergenic
914261175 1:146000438-146000460 TAACAATTGTAAGCCAGGTGTGG + Intergenic
914701279 1:150136261-150136283 AAAAAATTTGAGGCCGGGTGCGG + Intronic
914769293 1:150669669-150669691 ATACATCTGTAGGCCGGGCGCGG + Intronic
914821719 1:151109647-151109669 AAAAAACTATAGGCCGGGTGTGG - Intronic
915183586 1:154084500-154084522 AAAAAATTTAAGGCCGGGTGCGG - Intronic
915223683 1:154395421-154395443 AGAAAACTCTAGGCCGGGTGCGG - Intergenic
915295611 1:154919256-154919278 AAACAAAAGTCGGCCGGGTGTGG + Intergenic
915421027 1:155781749-155781771 AAATAATAATAGGCCGGGTGCGG - Intronic
915428726 1:155848855-155848877 ACGGAATTGTAGGTCGGGCGCGG + Intronic
916063289 1:161116942-161116964 AGACAGCTGTAGGCCGGGAGCGG + Intronic
916311540 1:163404201-163404223 ACACAAAAATAGTCCGGGTGCGG - Intergenic
916409740 1:164534500-164534522 ACATAGCTGCAGGCCGGGTGAGG + Intergenic
916700213 1:167285312-167285334 AGACTATTTTTGGCCGGGTGCGG + Intronic
916752021 1:167731726-167731748 ACACAGTTTTAGGCTGGGTGCGG - Intronic
917235840 1:172891009-172891031 ATACAAAAGTAGGCCGGGCGCGG + Intergenic
917338979 1:173954934-173954956 CCACAATCTTAGGCTGGGTGTGG + Intronic
917349207 1:174059226-174059248 AGAAATTTGTAGGCCGGGTGCGG + Intergenic
917664725 1:177214139-177214161 AAAGAATTAAAGGCCGGGTGCGG + Intronic
917766743 1:178228289-178228311 AAAAAATTGTGGGCCGGGTGCGG + Intronic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
918642903 1:186864800-186864822 ATACAACTATAGGCCAGGTGTGG + Intronic
918900341 1:190408332-190408354 TGACAAATGTAGGCCGGATGCGG - Intronic
919068425 1:192723407-192723429 AAACAATTTTGGGCCGGGCGTGG - Intergenic
919089845 1:192964952-192964974 AAAGAATTTTAGGCCTGGTGTGG + Intergenic
919645360 1:200089445-200089467 ACAAAGTTGCAGGCCAGGTGTGG - Intronic
920105666 1:203551579-203551601 ACCAAACTGTAGGCCGGGCGTGG - Intergenic
920242634 1:204564427-204564449 ACAGAGTGATAGGCCGGGTGCGG + Intergenic
920339383 1:205266298-205266320 ACATAATTTTGGGCCGGGCGCGG + Intronic
920428575 1:205899059-205899081 ACACACATTTAGGCCAGGTGTGG - Intergenic
921140863 1:212305019-212305041 AAAAAATTGGGGGCCGGGTGTGG - Intronic
921284682 1:213598625-213598647 ACATTATTTTAGGCCGGGTGTGG + Intergenic
921423460 1:214975351-214975373 ACACAATTTCAGCCCAGGTGAGG + Intergenic
922040704 1:221893596-221893618 ACAAACTTATAGGCTGGGTGCGG + Intergenic
922127564 1:222743446-222743468 AAACAATTCATGGCCGGGTGTGG - Intronic
922276914 1:224087785-224087807 AGACAAGTGAAGGCCGGGCGCGG + Intergenic
922286080 1:224171789-224171811 ACCCAAGTAGAGGCCGGGTGCGG - Intergenic
922296646 1:224255480-224255502 ACACCATTTTAGGCCAGGCGCGG - Intronic
922490953 1:226016106-226016128 ATACAATTGCAGGCTGGGCGTGG - Intergenic
922625465 1:227036718-227036740 ACTGAATTGAAGGCCGGGCGCGG - Intronic
922924088 1:229333140-229333162 AAACATTTCTAGGCCGGGCGCGG + Intronic
923185375 1:231568168-231568190 AAACAATTGAGGGCTGGGTGTGG + Intronic
923212915 1:231821989-231822011 AAGCAGTTGTAGGCCGGGCGCGG - Intronic
923576584 1:235164035-235164057 AAACAAAAGGAGGCCGGGTGCGG + Intronic
923642792 1:235782461-235782483 TCCCCATTGTAGGCCGGGTGTGG - Intronic
923900615 1:238322387-238322409 ACACTTGTTTAGGCCGGGTGTGG + Intergenic
924046838 1:240040579-240040601 AAACAACTATAGGCCGGGCGCGG - Intronic
924055021 1:240116598-240116620 ACAGAAATGTTGGCTGGGTGTGG + Intronic
924091915 1:240510077-240510099 AGCAAATGGTAGGCCGGGTGCGG + Intronic
924105893 1:240648870-240648892 ATACAAGGGCAGGCCGGGTGCGG + Intergenic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924670069 1:246114918-246114940 AACCAAGTTTAGGCCGGGTGCGG - Intronic
1062989541 10:1803096-1803118 ACACAAATATTAGCCGGGTGAGG + Intergenic
1063112771 10:3051399-3051421 ACAAGATCGTAGGCCGGGTGCGG + Intergenic
1063562910 10:7146819-7146841 ACACAATCTTGGGCCGGGCGCGG - Intergenic
1063996814 10:11627368-11627390 TAAAAATTGTAGGCCGGGCGCGG - Intergenic
1064102522 10:12476000-12476022 AGAGAAGTCTAGGCCGGGTGGGG + Intronic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064218329 10:13418710-13418732 AAATAATTCTAGGCCGGGTGTGG - Intergenic
1064673479 10:17738795-17738817 AAAGAGTTCTAGGCCGGGTGTGG - Intergenic
1065345409 10:24743480-24743502 ATTCAATTGTAGGCTGGGAGCGG - Intergenic
1065345862 10:24747611-24747633 ACACAAAAATTGGCCGGGTGTGG - Intergenic
1065440426 10:25748157-25748179 AGAGTATTCTAGGCCGGGTGTGG - Intergenic
1065525708 10:26618399-26618421 ACATATTTTTGGGCCGGGTGCGG - Intergenic
1065605272 10:27412438-27412460 AAACAGTTTTAGGCTGGGTGTGG - Intronic
1065850282 10:29782068-29782090 ACAGAAATTAAGGCCGGGTGCGG + Intergenic
1066348074 10:34608822-34608844 AAAAATTTGTAGGCTGGGTGCGG - Intronic
1066381389 10:34905087-34905109 ACACAAATATGGGCTGGGTGTGG - Intergenic
1066413813 10:35200176-35200198 ATTCAATTTTAGGCTGGGTGTGG - Intronic
1066414985 10:35213557-35213579 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1066536259 10:36395640-36395662 AAAGAGTTTTAGGCCGGGTGTGG + Intergenic
1066538647 10:36419965-36419987 AGACTATTGTTGGCTGGGTGTGG - Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067001246 10:42615930-42615952 AAACAATTGTCGGCTGGGTGCGG + Intronic
1067115445 10:43432330-43432352 AAAAAATTTTAGGCCAGGTGCGG - Intergenic
1067988531 10:51181529-51181551 AAAAAATTCTAGGCCGGGCGCGG - Intronic
1068062783 10:52090101-52090123 ACAACAATCTAGGCCGGGTGTGG - Intronic
1068079828 10:52306374-52306396 AAAAAAATCTAGGCCGGGTGTGG - Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068189798 10:53636118-53636140 AAAAAATTACAGGCCGGGTGTGG - Intergenic
1068211151 10:53922794-53922816 ACACAAATATAGGTCAGGTGTGG + Intronic
1068527637 10:58148374-58148396 ACTCAATTCTTGGCCGGGCGCGG - Intergenic
1068585045 10:58788793-58788815 AAACACTTGTAGGCCAGTTGTGG + Intronic
1069000921 10:63263639-63263661 ATACAAATGAAGGCCAGGTGTGG + Intronic
1069032801 10:63615833-63615855 CCACAAGTTTAGGCTGGGTGTGG - Intronic
1069143037 10:64852202-64852224 AAACACTTGGAGGCCGGGTGTGG - Intergenic
1069216894 10:65832211-65832233 AGAAATTTGTTGGCCGGGTGCGG + Intergenic
1069221137 10:65885138-65885160 AAACAATTTTAGGCCGGGCGCGG - Intergenic
1069672507 10:70220218-70220240 GCATAATTGCAGGCCAGGTGCGG - Intronic
1070000402 10:72372076-72372098 AAATAAATGTAGGCCAGGTGTGG + Intronic
1070019451 10:72569523-72569545 ATATAATTTTAGGCCGGGTGTGG - Intronic
1070036060 10:72725596-72725618 ATATTAATGTAGGCCGGGTGCGG + Intronic
1070176887 10:73978302-73978324 AAGTAATAGTAGGCCGGGTGCGG + Intergenic
1070193940 10:74139489-74139511 AAACAATTTCAGGCCGGGCGTGG + Intronic
1070253462 10:74793883-74793905 TTACATTTGTGGGCCGGGTGCGG + Intergenic
1071132219 10:82407778-82407800 AGAAAAATATAGGCCGGGTGTGG + Intronic
1071692934 10:87841903-87841925 ACCCACTGATAGGCCGGGTGCGG + Intergenic
1072045985 10:91655701-91655723 AAAAAATTGTTGGCCGGGCGTGG - Intergenic
1072112136 10:92332872-92332894 TCACATTTGTTGGCCGGGTGCGG + Intronic
1072212424 10:93258740-93258762 ACAAAAAAGCAGGCCGGGTGCGG + Intergenic
1072350674 10:94553836-94553858 AAACAATTGAAGGCCGGGTGCGG - Intronic
1072355770 10:94608924-94608946 AGAAAATTGTGGGCTGGGTGCGG - Intronic
1072461492 10:95622825-95622847 AAAAAATTCTGGGCCGGGTGCGG - Intronic
1072708890 10:97702576-97702598 ACAATATTGATGGCCGGGTGCGG + Intergenic
1072786803 10:98288995-98289017 ATGCAATTGCAGGCCGGGCGCGG - Intergenic
1072823822 10:98585558-98585580 ACACTACTGTAGGCCGGGCTTGG - Intronic
1072882747 10:99244305-99244327 ATACCGTTGTAGGCCGGGCGTGG - Intergenic
1073031686 10:100531079-100531101 TCACCCTTTTAGGCCGGGTGCGG + Intronic
1073059908 10:100727420-100727442 ATAGAATTGTTGGCCGGGCGTGG - Intergenic
1073172895 10:101527460-101527482 AGAATATTGTTGGCCGGGTGGGG + Intronic
1073276217 10:102313851-102313873 ACACAATTGCAGGCTGGGCTAGG + Intronic
1073334598 10:102696552-102696574 AAAAAACTGTTGGCCGGGTGCGG - Intronic
1073360421 10:102894133-102894155 ATAAAATTCTAGGCCGGGCGCGG + Intronic
1073796102 10:106989974-106989996 AAACATGGGTAGGCCGGGTGTGG - Intronic
1073968216 10:109015634-109015656 ACAGTATTTTAGGCCGGGAGCGG + Intergenic
1074047739 10:109854187-109854209 ACACTATACTCGGCCGGGTGTGG + Intergenic
1074097875 10:110330005-110330027 ACATTATTCTAGGCCGGGCGTGG + Intergenic
1074113528 10:110439007-110439029 ACACAAGTCTAGGCTGGGTGCGG - Intergenic
1074569892 10:114614761-114614783 ACACAAGTGTGGGCTGGGCGTGG + Intronic
1075174276 10:120144761-120144783 AGACAAATGCAGGCTGGGTGTGG + Intergenic
1075315070 10:121446747-121446769 AAAGAATAGTGGGCCGGGTGTGG + Intergenic
1075366294 10:121892986-121893008 AAGCAATTGTAGGCCGGGCACGG + Intronic
1075386505 10:122059204-122059226 ACACAGATGGAGCCCGGGTGTGG - Intronic
1075706240 10:124503354-124503376 ACACCAATGAAGGCCGGATGTGG - Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1076259341 10:129053343-129053365 AAAAAATTTTGGGCCGGGTGCGG - Intergenic
1077203013 11:1322526-1322548 AGACATATATAGGCCGGGTGCGG + Intergenic
1077212474 11:1378170-1378192 AAAGAGTTATAGGCCGGGTGCGG + Intergenic
1078201984 11:9191528-9191550 ACCCAAAAGTTGGCCGGGTGCGG - Intronic
1078499987 11:11862845-11862867 TTACACTTGTAGGCTGGGTGTGG - Intronic
1078618393 11:12885525-12885547 AGACAATTCAAGCCCGGGTGCGG - Intronic
1079202572 11:18388140-18388162 AAACAAGTGTTGGCCGGGCGCGG + Intergenic
1079250853 11:18786490-18786512 CCCCTATTCTAGGCCGGGTGCGG - Intronic
1079431703 11:20396346-20396368 ATCAAAATGTAGGCCGGGTGCGG + Intronic
1079852000 11:25546443-25546465 AAGCAATTATGGGCCGGGTGCGG - Intergenic
1079914330 11:26349836-26349858 AAACAATTCTCGGCCGGGCGTGG - Intronic
1080155574 11:29106703-29106725 AGAAAATTATAGGCTGGGTGTGG - Intergenic
1080351481 11:31390415-31390437 AAAAAATTAAAGGCCGGGTGCGG + Intronic
1080624927 11:34020362-34020384 AAACAATTTTAGGCCAGGTGTGG + Intergenic
1080674704 11:34414581-34414603 ATACAATTGTAGGCCAGGCATGG - Intergenic
1080812696 11:35721192-35721214 AAAGAATTATAGGCCAGGTGTGG - Intronic
1081704805 11:45176089-45176111 AAACAATTTTTGGCCGGGTGTGG + Intronic
1081831170 11:46116671-46116693 ACAAAAATTTAGGCCGGGCGTGG + Intronic
1081923283 11:46799706-46799728 AATGAATTTTAGGCCGGGTGTGG + Intronic
1082021387 11:47536466-47536488 CTGCATTTGTAGGCCGGGTGTGG + Intronic
1082083767 11:48032461-48032483 TAACAAATCTAGGCCGGGTGCGG + Intronic
1082176405 11:49065307-49065329 ATTCAATTTTGGGCCGGGTGCGG - Intergenic
1083029913 11:59583018-59583040 ACTCAATTCCAGGCCAGGTGGGG + Intronic
1083138238 11:60700253-60700275 ACACTATGAGAGGCCGGGTGCGG + Intronic
1083357711 11:62079448-62079470 ACACAAATATAGGCCGGGCACGG - Intergenic
1083398544 11:62408062-62408084 ACAGAATTGGAGTCCAGGTGCGG - Intronic
1083576961 11:63798870-63798892 CCCCAATTCTAGGCCAGGTGTGG - Intergenic
1083798035 11:65029444-65029466 AGCCAATGGGAGGCCGGGTGTGG - Intronic
1083820382 11:65167591-65167613 AAACAACTTTAGGCCGGGCGCGG - Intergenic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1083947124 11:65930086-65930108 AAAAAATTTTAGGCCGGGTGTGG + Intergenic
1084053095 11:66613934-66613956 AACTAATTGTAGGCTGGGTGTGG - Intergenic
1084101544 11:66952831-66952853 AAACAGTTCTTGGCCGGGTGCGG - Intronic
1084130920 11:67133691-67133713 CCACAGTTGGAAGCCGGGTGCGG - Intronic
1084131590 11:67139992-67140014 ACACAGGAGTAGGCCAGGTGCGG - Intronic
1084135723 11:67179568-67179590 ACAGCATTCCAGGCCGGGTGCGG - Intronic
1084382425 11:68821441-68821463 ACAAAAATGTAGGCCGGGCGCGG - Intronic
1084491117 11:69478962-69478984 AAACAAGTGTGGGCCAGGTGCGG + Intergenic
1084853849 11:71967159-71967181 ACACAAATATTGGCCGGGCGCGG - Intronic
1084864392 11:72043654-72043676 AGACAACTGTGGGCCAGGTGTGG - Intronic
1084994421 11:72961544-72961566 AAACAATAGTAGGCCAGGTATGG - Intronic
1085086247 11:73669524-73669546 ACAGAGATGGAGGCCGGGTGCGG + Intergenic
1085137832 11:74109780-74109802 AAAGAATTTGAGGCCGGGTGCGG + Intronic
1085276440 11:75303155-75303177 ACACAATAATTAGCCGGGTGTGG - Intronic
1085305214 11:75481943-75481965 ACACAATTGGGGGCAGGGAGGGG + Intronic
1085338404 11:75715275-75715297 ACATTAGTGTAGGCCGGGCGCGG + Intergenic
1085384241 11:76147876-76147898 AGAAAATTTTAGGCCGGGCGCGG + Intergenic
1085635295 11:78154519-78154541 ACACTATTGTAGGCACGGTGTGG + Intergenic
1086144292 11:83534642-83534664 AAACAATGTAAGGCCGGGTGCGG + Intronic
1086165374 11:83772115-83772137 AGAAAAATCTAGGCCGGGTGCGG + Intronic
1086357942 11:86025109-86025131 AAAAAATAGCAGGCCGGGTGTGG + Intronic
1087163598 11:94975224-94975246 ACACAAGTGTTGGAGGGGTGGGG - Intronic
1087237934 11:95741155-95741177 ACACAAAAGTTAGCCGGGTGTGG - Intergenic
1087412776 11:97813001-97813023 ACACATTGATTGGCCGGGTGCGG + Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087764335 11:102133585-102133607 AAACAATTCTAGGCCAGGCGTGG - Intronic
1088035732 11:105311998-105312020 AAACAATTATAGGCTGGGCGTGG - Intergenic
1088195860 11:107272989-107273011 TAACAATTATGGGCCGGGTGCGG + Intergenic
1088219167 11:107549139-107549161 TCAGAATTTTAGGCTGGGTGCGG - Intronic
1088243362 11:107793070-107793092 ACACAAAAATTGGCCGGGTGTGG - Intronic
1088245349 11:107813152-107813174 ACACAGAATTAGGCCGGGTGCGG + Intronic
1088298970 11:108334818-108334840 CTACAACTTTAGGCCGGGTGTGG - Intronic
1088686386 11:112287607-112287629 AAATAAATGTTGGCCGGGTGCGG + Intergenic
1089240262 11:117071907-117071929 ACACAACTCTTGGCTGGGTGTGG - Intronic
1089433889 11:118446056-118446078 AAAGATTTGCAGGCCGGGTGGGG + Intronic
1089673071 11:120070279-120070301 TAAAAATTCTAGGCCGGGTGTGG + Intergenic
1089717354 11:120374095-120374117 ATACATTTTTTGGCCGGGTGCGG - Intronic
1089819290 11:121209111-121209133 ATACAATAGCAGGCCGGGCGCGG - Intergenic
1089964691 11:122646239-122646261 AGACATTTCTAGGCCGGGAGCGG + Intergenic
1090127374 11:124101497-124101519 AAAAAAATGTAGGCCAGGTGTGG + Intergenic
1090770898 11:129919078-129919100 AAGCCAGTGTAGGCCGGGTGTGG + Intronic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1091419165 12:320204-320226 AAACTATTTTAGGCCGGGTGCGG + Intronic
1091478309 12:799419-799441 ACAGACATGCAGGCCGGGTGCGG - Intronic
1091504946 12:1057882-1057904 AAAAAATTTTAGGCCGGGTGCGG - Intronic
1092133637 12:6130561-6130583 ACATGCTTGTCGGCCGGGTGCGG - Intergenic
1092232119 12:6781915-6781937 AAAAAATGGTAGGCTGGGTGTGG - Intergenic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1093127508 12:15348466-15348488 AAAAAATTATAGGCCGGGCGCGG + Intronic
1093503979 12:19843502-19843524 AAAGAGTTCTAGGCCGGGTGCGG + Intergenic
1094111171 12:26864188-26864210 ACACCATCATAGGCCAGGTGCGG - Intergenic
1094125323 12:27017116-27017138 AAAAAATTACAGGCCGGGTGTGG - Intergenic
1094215613 12:27939070-27939092 AAACAAAAGTAGGCCGGGTGTGG + Intergenic
1094531848 12:31283310-31283332 ATACATGTGTGGGCCGGGTGTGG + Intronic
1094607558 12:31961930-31961952 ACGTATTTGTAGGCCAGGTGTGG + Intronic
1094708894 12:32941511-32941533 AAAGAATTATGGGCCGGGTGCGG - Intergenic
1094820866 12:34223143-34223165 ACACAAAGGTTAGCCGGGTGTGG + Intergenic
1095226305 12:39681114-39681136 ACACAAAAGTCAGCCGGGTGTGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1095446039 12:42283493-42283515 AAAAAATTGCAGGCTGGGTGTGG - Intronic
1095774620 12:45998922-45998944 AGTTCATTGTAGGCCGGGTGTGG - Intergenic
1096074079 12:48791116-48791138 ATGAAATTTTAGGCCGGGTGCGG + Intergenic
1096293347 12:50361487-50361509 ACACACACATAGGCCGGGTGTGG - Intronic
1096470900 12:51875042-51875064 ATACAAAAGTAAGCCGGGTGTGG + Intergenic
1096523681 12:52198398-52198420 ACAAAATTCTAGGACTGGTGGGG - Intergenic
1096576657 12:52557040-52557062 TAAAAATTGTAGGCCGGGTGTGG + Intergenic
1096631613 12:52930509-52930531 ACAGAATTGGGGGCCGGGCGTGG - Intronic
1096722811 12:53536595-53536617 ATACAATTGCTGGCCGGGCGCGG + Intronic
1097220323 12:57446224-57446246 AAAAATTTTTAGGCCGGGTGTGG - Intronic
1097229863 12:57503828-57503850 AAACAAGTGTGGGCCGGGCGCGG - Intronic
1097511515 12:60547920-60547942 AAAAAATTGGGGGCCGGGTGTGG + Intergenic
1097980415 12:65732460-65732482 AAAAAATAGTTGGCCGGGTGCGG + Intergenic
1098276595 12:68818082-68818104 TTCCAAATGTAGGCCGGGTGTGG - Intronic
1098338326 12:69425951-69425973 ATACAATATTAGGCCAGGTGTGG + Intergenic
1098420472 12:70291645-70291667 ACACCATGGTAGGCCAGGCGTGG + Intronic
1098548212 12:71733758-71733780 AATCAGTTGTAGGCCGGGCGTGG - Intergenic
1098870428 12:75811534-75811556 ATATATTTGTAGGCCAGGTGCGG + Intergenic
1099275590 12:80571426-80571448 AAAGAATTGTAGGCTGGGTGTGG - Intronic
1099421036 12:82460851-82460873 ACCATATTGTAGGCCGGGCGCGG + Intronic
1099728464 12:86465916-86465938 ACCTAAATGTAGGCCGGGAGTGG + Intronic
1100211980 12:92407166-92407188 AGAATCTTGTAGGCCGGGTGTGG + Intergenic
1100514842 12:95317382-95317404 AAACAAATATAGGCCAGGTGCGG - Intergenic
1100836904 12:98574950-98574972 AAACAAAAGTAGGCTGGGTGCGG + Intergenic
1100893360 12:99151235-99151257 AAACAATTGGGGGCCAGGTGTGG + Intronic
1101034888 12:100695466-100695488 AAACAATTTAAGGCCGGGCGCGG + Intergenic
1101650347 12:106671950-106671972 ACAACACTGGAGGCCGGGTGTGG - Intronic
1101661339 12:106768175-106768197 ACAGAATTGTAGGGCTGTTGAGG - Intronic
1101726517 12:107392721-107392743 ACACAACTGTAGGCTCTGTGAGG + Intronic
1101793652 12:107953320-107953342 AGACCATTGTCGGCCGGGTGTGG - Intergenic
1101982322 12:109418104-109418126 ACCCAATCTTAGGCCGGGCGCGG - Intronic
1102125068 12:110473500-110473522 ACTCTATTGTGGGCTGGGTGTGG - Intronic
1102177226 12:110884989-110885011 AGACAATTACAGGCCAGGTGTGG - Intronic
1102270670 12:111532188-111532210 AAATAATTTGAGGCCGGGTGCGG + Intronic
1102343221 12:112140128-112140150 ACTGAATTGGAGGCCGGGCGTGG + Intronic
1102394829 12:112576507-112576529 ACAAAAATTAAGGCCGGGTGAGG - Intronic
1102639120 12:114350930-114350952 ACACATTTGTGGGCCAGGTGTGG - Intergenic
1102978200 12:117221572-117221594 AAACAAATTTAGGCCGGGTGTGG - Intronic
1103056373 12:117824564-117824586 AAAAAATTTTAGGCCGGGCGCGG + Intronic
1103092471 12:118107028-118107050 AAAAAATTCCAGGCCGGGTGTGG - Intronic
1103124467 12:118409433-118409455 ACAGAATTTTAGGCCGGGCGTGG - Intronic
1103224603 12:119276008-119276030 ACACAAACGTTGTCCGGGTGTGG - Intergenic
1103300488 12:119922621-119922643 ACACAACTTTCGGCCGGGTGAGG + Intergenic
1103319312 12:120081637-120081659 ATAAAACTGGAGGCCGGGTGTGG - Intronic
1103319640 12:120084290-120084312 ATAAAAGTGTTGGCCGGGTGTGG - Intronic
1103320426 12:120089670-120089692 ACAGAAGTTGAGGCCGGGTGTGG - Intronic
1103383333 12:120512310-120512332 ACTAAATTGTAGGACGGGCGCGG + Intronic
1103386591 12:120537334-120537356 AAACTCATGTAGGCCGGGTGCGG + Intronic
1103399794 12:120636009-120636031 ACACAGTTCTGGGCCGGGCGCGG + Intergenic
1103514608 12:121499409-121499431 AAAAAATTATTGGCCGGGTGTGG - Intronic
1103582293 12:121924403-121924425 ACACAAGTCTAGGCCGGGCGTGG - Intronic
1103582346 12:121924718-121924740 ACACAAGTCTAGGCCGGGCGTGG - Intronic
1103638694 12:122330889-122330911 ACTACATTGTAGGCCGGGCGTGG - Intronic
1103671472 12:122619700-122619722 AAACAAGTGTTGGCCGGGCGCGG - Intronic
1103688485 12:122751869-122751891 AAAAAATTGTAGGCCGGGCGCGG + Intergenic
1103731432 12:123030401-123030423 AGATACTTGTAGGCCGGGCGCGG + Intronic
1103773563 12:123348331-123348353 ACATTTTTGTAGGCCGGGAGTGG + Intronic
1103785020 12:123426097-123426119 ACAAAAATTTAGGCCGGGTTTGG - Intronic
1104430384 12:128711242-128711264 ACACAACTGCGGGCCGGGCGCGG + Intergenic
1104452531 12:128882567-128882589 AAACATTTGCAGGCTGGGTGTGG - Intronic
1104574524 12:129954938-129954960 ACACAAAGATAGGCTGGGTGCGG - Intergenic
1104984803 12:132590659-132590681 ATACAAAATTAGGCCGGGTGTGG - Intergenic
1105063649 12:133177898-133177920 AAAAAATCCTAGGCCGGGTGCGG + Intronic
1105238101 13:18580141-18580163 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1105343311 13:19548826-19548848 AAGCAACTGTAGGCCAGGTGCGG + Intergenic
1105383279 13:19907014-19907036 ACAAAATTGCAGTCCAGGTGTGG - Intergenic
1105406215 13:20134639-20134661 AAAAAAATCTAGGCCGGGTGCGG - Intergenic
1105423003 13:20269759-20269781 ACACAGTTGCAGGCCAGGCGCGG + Intergenic
1105515608 13:21087557-21087579 ATGCAATTGATGGCCGGGTGTGG - Intergenic
1105536999 13:21275270-21275292 AAGCAACTGTAGGCCAGGTGCGG - Intergenic
1105744398 13:23363197-23363219 AAATAAATGTAGGCCAGGTGCGG - Intronic
1106051674 13:26196358-26196380 AAACATTTTCAGGCCGGGTGTGG + Intronic
1106175638 13:27328868-27328890 ACCAAACTGTAGGCCGGGTGCGG + Intergenic
1106189280 13:27437039-27437061 ATACAATTGTAGGCCAGGCGCGG - Intronic
1106265423 13:28105399-28105421 AGAAAATTAAAGGCCGGGTGCGG + Intergenic
1106590680 13:31095921-31095943 TAACAATTTCAGGCCGGGTGCGG - Intergenic
1107001137 13:35546841-35546863 AAAAAATTTTAGGCCGGGAGCGG - Intronic
1107193471 13:37619536-37619558 ACAACCTTGTAGGCCGGGCGCGG + Intergenic
1107649434 13:42529279-42529301 AGAAAATTCCAGGCCGGGTGCGG - Intergenic
1107854269 13:44599305-44599327 ACAGAATTGGAGCCCAGGTGTGG - Intergenic
1107915204 13:45142807-45142829 AAACAAGTGTAGGATGGGTGGGG + Intronic
1107932636 13:45318979-45319001 AGAAAACTGGAGGCCGGGTGCGG + Intergenic
1108056324 13:46489090-46489112 AACCAACTGTGGGCCGGGTGAGG + Intergenic
1108352736 13:49601943-49601965 ATAAATTAGTAGGCCGGGTGCGG - Intergenic
1108420102 13:50240065-50240087 AAAAAATAGTGGGCCGGGTGCGG - Intronic
1108621033 13:52183916-52183938 ATATAAATGTCGGCCGGGTGCGG - Intergenic
1108679032 13:52763561-52763583 ACCCAATAGATGGCCGGGTGTGG + Intergenic
1109190362 13:59315615-59315637 AACCAATTGGAGGCCAGGTGCGG - Intergenic
1109274247 13:60286377-60286399 AAATTATTTTAGGCCGGGTGCGG + Intergenic
1109578767 13:64298234-64298256 ATAAAAATGTAGGCCGGGCGCGG + Intergenic
1109737830 13:66509741-66509763 AGACTATTGCAGGCCGGGTGTGG - Intronic
1109833405 13:67823972-67823994 AAATATTTTTAGGCCGGGTGCGG - Intergenic
1109864067 13:68239396-68239418 AAAAAGCTGTAGGCCGGGTGCGG + Intergenic
1110425410 13:75361668-75361690 AAAAAATTGTAGGCCCGGCGCGG - Intronic
1110431957 13:75434855-75434877 ACACAATTATAGGCCTGGTACGG + Intronic
1111298059 13:86309090-86309112 ATATAAATGTAGGCCGGGTGCGG + Intergenic
1111655606 13:91148903-91148925 ACAAAACTCTAGGCCAGGTGCGG + Intergenic
1111936914 13:94567120-94567142 ACAAAATTATGGGCCAGGTGCGG - Intergenic
1112081902 13:95981172-95981194 ACACTTTTGTTGGCCGGGCGCGG + Intronic
1112510105 13:100001250-100001272 ATACAAAAATAGGCCGGGTGTGG - Intergenic
1113044449 13:106140464-106140486 TAACAATAATAGGCCGGGTGCGG - Intergenic
1113151843 13:107272502-107272524 AAAAAATTCTAGGCCGGGCGCGG - Intronic
1113326345 13:109285300-109285322 ACAAATATATAGGCCGGGTGCGG - Intergenic
1113802380 13:113093288-113093310 ACACAGATGCAGGCCTGGTGTGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1113988154 13:114335889-114335911 ACAAACATGTGGGCCGGGTGTGG + Intergenic
1114007464 14:18330631-18330653 TAACAAATGCAGGCCGGGTGCGG - Intergenic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114442771 14:22764078-22764100 AAAAAATACTAGGCCGGGTGTGG - Intergenic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1114929788 14:27452460-27452482 ACATAATTTGAGGCCGGGCGTGG - Intergenic
1115191221 14:30749253-30749275 TTACAAGTTTAGGCCGGGTGTGG - Intergenic
1115574529 14:34697637-34697659 ACTCACTTCTAGGCTGGGTGCGG + Intergenic
1115611078 14:35049180-35049202 TCACAACAGGAGGCCGGGTGCGG - Intronic
1116248236 14:42445792-42445814 ACACCACTGTGGGCCGGGCGTGG - Intergenic
1116261721 14:42636790-42636812 ATCCAGGTGTAGGCCGGGTGCGG - Intergenic
1116311319 14:43330051-43330073 AAACATTATTAGGCCGGGTGTGG + Intergenic
1116316314 14:43398736-43398758 AAACAACTGTAGGCTGGGCGCGG - Intergenic
1116334481 14:43639718-43639740 ACACAAGTGAAGGCTGGGTCAGG - Intergenic
1116823594 14:49649434-49649456 AAAGAAATATAGGCCGGGTGTGG - Intronic
1116852183 14:49919461-49919483 ACACAAATATGGGCCGGGCGCGG + Intergenic
1117722653 14:58642536-58642558 ACACAAAAATCGGCCGGGTGTGG + Intronic
1118016670 14:61667856-61667878 GTACAGTTTTAGGCCGGGTGTGG - Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118271827 14:64350618-64350640 AAAAAATTCTAGGCTGGGTGCGG + Intergenic
1118349597 14:64964231-64964253 ACCCACTTTTAGGCCGGGCGTGG + Intronic
1119280392 14:73401857-73401879 AAACAAATTTAGGCCGGATGTGG - Intronic
1119674374 14:76542856-76542878 ACAAATGTATAGGCCGGGTGCGG + Intergenic
1119677957 14:76570226-76570248 ACATGACTTTAGGCCGGGTGCGG - Intergenic
1119743869 14:77030591-77030613 AAACAAATTGAGGCCGGGTGAGG - Intergenic
1119815692 14:77564947-77564969 ACACCAAGGTAAGCCGGGTGCGG + Intronic
1120114067 14:80593254-80593276 ACCCTGTTGTCGGCCGGGTGAGG + Intronic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1120419783 14:84269270-84269292 ATACAATTTCAGGCCGGGCGCGG + Intergenic
1120840084 14:89077924-89077946 AGACAATTGTAGGTGGGGTTGGG + Intergenic
1120955725 14:90080161-90080183 AAACAATTGAAGGCCAGGTGTGG + Intronic
1120982868 14:90306518-90306540 GCACTAATGTAGGCCGGGTGTGG + Intronic
1121198420 14:92096332-92096354 AAAGAAATGTAAGCCGGGTGTGG + Intronic
1121239556 14:92418990-92419012 ACACAAAAATTGGCCGGGTGCGG - Intronic
1121344389 14:93124619-93124641 ATAAAAATGTAGGCTGGGTGTGG - Intergenic
1121627981 14:95400627-95400649 ACACTTTGGGAGGCCGGGTGTGG + Intergenic
1121651215 14:95560322-95560344 ACAGAAATTTTGGCCGGGTGTGG + Intergenic
1121716771 14:96081888-96081910 AAACATTTGTTGGCCGGGTGCGG - Intronic
1122167812 14:99842959-99842981 GCACAGTTCTAGGCTGGGTGTGG + Intronic
1122464266 14:101919675-101919697 AGCCAATTCTTGGCCGGGTGTGG + Intronic
1122618420 14:103037738-103037760 AAAGAATTTTAGGCCGGGCGTGG + Intronic
1122696431 14:103555272-103555294 ATACAATGGAAGGCCGGGCGCGG + Intergenic
1122725732 14:103750538-103750560 ACTGGATTGCAGGCCGGGTGCGG + Intronic
1123107968 14:105851840-105851862 ACACAACTGGAGGCCGGGCGGGG + Intergenic
1123690552 15:22835182-22835204 AAATACTTGCAGGCCGGGTGCGG - Intergenic
1123743378 15:23300215-23300237 AAAAAAATATAGGCCGGGTGTGG + Intergenic
1123900871 15:24875761-24875783 TAAAAATTTTAGGCCGGGTGCGG + Intronic
1124131857 15:26996940-26996962 ACACCAGTATAGGCCGGGCGTGG - Intronic
1124205729 15:27718427-27718449 ACACAAGTGTTGGCCAGATGAGG - Intergenic
1124306815 15:28585945-28585967 AAAAAAATATAGGCCGGGTGTGG + Intergenic
1124448358 15:29760665-29760687 ACACTAGTGTTGGCCGGGCGCGG - Intronic
1124464900 15:29928651-29928673 ACACACTTGTCGGCCGGGCACGG + Intronic
1124510697 15:30322005-30322027 GCATAATTGAAGGCCAGGTGTGG - Intergenic
1124704279 15:31948806-31948828 ATAAAATAGTAGGCCGGGCGCGG - Intergenic
1124742307 15:32310293-32310315 AGACAATTTTCAGCCGGGTGCGG - Intergenic
1124899065 15:33805765-33805787 ACAAAAGAGAAGGCCGGGTGTGG - Intronic
1125068039 15:35515429-35515451 ACAAAAATTAAGGCCGGGTGCGG + Intronic
1125495293 15:40187414-40187436 AAAAAATTGTTGACCGGGTGCGG - Intronic
1125543674 15:40487432-40487454 AAAAAATTGTTGGCCGGGCGCGG + Intergenic
1125559272 15:40614386-40614408 ATACAAAATTAGGCCGGGTGTGG - Intronic
1125646056 15:41273783-41273805 AAATAATAGTAGGCTGGGTGTGG + Intronic
1125649059 15:41298603-41298625 ACAAAAACCTAGGCCGGGTGTGG + Intergenic
1125989977 15:44096700-44096722 ACACACTACTAGGCTGGGTGTGG - Intronic
1125997588 15:44178702-44178724 ACCCAAGTCTAGGCCGGGTACGG + Intronic
1126148206 15:45497358-45497380 AAACTATATTAGGCCGGGTGCGG - Intronic
1126207039 15:46057773-46057795 AAACCATTGCTGGCCGGGTGCGG + Intergenic
1126214101 15:46133735-46133757 TCACAAATATAGGCCAGGTGTGG - Intergenic
1126601123 15:50428405-50428427 ACTAAATTGTAGGCCCGGCGTGG - Intronic
1126698539 15:51346773-51346795 ACAAACTAGGAGGCCGGGTGTGG + Intronic
1126776769 15:52107098-52107120 AGGCAATATTAGGCCGGGTGTGG + Intergenic
1127264550 15:57350953-57350975 AAGCAATCATAGGCCGGGTGCGG + Intergenic
1127501499 15:59558066-59558088 AATAAATTGAAGGCCGGGTGCGG + Intergenic
1127590664 15:60419136-60419158 ACAGCACTGGAGGCCGGGTGCGG - Intergenic
1127669298 15:61179844-61179866 ACAAAACCGTAGGCTGGGTGTGG + Intronic
1127679390 15:61278030-61278052 ACCCAATGGTAAGCCGGGCGCGG - Intergenic
1127813771 15:62588168-62588190 ATGTAATTTTAGGCCGGGTGCGG - Intronic
1127857589 15:62965395-62965417 AGAAAAATGTAGGCCGGGCGCGG - Intergenic
1127947937 15:63773833-63773855 ATACAAATTTAGGCTGGGTGCGG - Intronic
1128018085 15:64365290-64365312 AAACAATTTTTAGCCGGGTGCGG - Exonic
1128048540 15:64641502-64641524 GCACAAGTGTAGGCCAGGCGCGG - Intronic
1128138850 15:65284614-65284636 AGAAAATTATAGGCCGAGTGCGG - Intronic
1128258213 15:66213705-66213727 AAACAATTTAAGGCTGGGTGTGG - Intronic
1128297376 15:66535383-66535405 AGACCACTGTAGGCCGGGCGCGG + Intronic
1128316957 15:66666714-66666736 AAATAATTTTAGGCCGGGTGTGG + Intronic
1128472031 15:67962541-67962563 AAATGTTTGTAGGCCGGGTGAGG + Intergenic
1128914060 15:71543735-71543757 TCACAGATGTGGGCCGGGTGTGG + Intronic
1129128389 15:73466139-73466161 AAACAATTGGTGGCCGGGTGCGG - Intronic
1129278397 15:74462773-74462795 ACAAAATTTCAGGCCGGGCGTGG - Intergenic
1129286566 15:74530003-74530025 ACAAAATTTGAGGCCGGGCGCGG - Intergenic
1129369759 15:75083770-75083792 ACCCCATCGTTGGCCGGGTGCGG - Intronic
1129586732 15:76875348-76875370 ACACAAACGTAGGCCAGGCGTGG + Intronic
1129836560 15:78711305-78711327 AAACAATTGCAGGCCAGGTGCGG - Intronic
1129858079 15:78839332-78839354 AAACAACTGTTGGCCGGATGTGG - Intronic
1130214717 15:81957383-81957405 AAAAAATTTTAGGCCGGGCGTGG - Intergenic
1130215992 15:81970350-81970372 ATACAAGTCTAGGCCTGGTGTGG + Intergenic
1130308941 15:82735864-82735886 ATACCAATGTAGGCCAGGTGTGG + Intergenic
1130371814 15:83291293-83291315 ACACAAAAATTGGCCGGGTGTGG - Intergenic
1130537262 15:84796064-84796086 ATACAAAAGTAAGCCGGGTGTGG + Intronic
1131009920 15:89008747-89008769 AACCAATTGTAGGCTGTGTGTGG - Intergenic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1131161933 15:90111329-90111351 ACATAATAATAGGCCGGGCGCGG + Intergenic
1131209426 15:90480956-90480978 ATACAAGTAGAGGCCGGGTGTGG - Intronic
1131531412 15:93195926-93195948 ACACAACTAGAGGCCCGGTGAGG - Intergenic
1132475657 16:136397-136419 ACACAAGTGCAGGCTGGGCGCGG + Intronic
1132483811 16:180219-180241 ACACAAAAATTGGCCGGGTGCGG - Intergenic
1132490373 16:225773-225795 ACAGAATTTCAGGCTGGGTGCGG - Intronic
1132491141 16:232019-232041 AAATAAATATAGGCCGGGTGTGG + Intergenic
1132812089 16:1805074-1805096 ACACAAGTTTAGGCCAGGTATGG - Intronic
1132817946 16:1843406-1843428 AAACAAGAGTAGGCCGGATGTGG + Intronic
1133011698 16:2916343-2916365 ACAAAAATACAGGCCGGGTGTGG + Intronic
1133142456 16:3757162-3757184 GCCCAATTTCAGGCCGGGTGTGG - Intronic
1133199068 16:4191320-4191342 ACCCAGGTGGAGGCCGGGTGCGG + Exonic
1133664226 16:7950079-7950101 ATAGAATTGTTGGCCGGGAGTGG + Intergenic
1133715479 16:8443181-8443203 AAAAACTTTTAGGCCGGGTGCGG - Intergenic
1133745735 16:8685378-8685400 AAACAATGTTACGCCGGGTGTGG + Intronic
1133950609 16:10388718-10388740 AAATATTTGTAGGCCGGGCGCGG + Intronic
1134123969 16:11603672-11603694 ACACAATTGCATGCCTGCTGAGG - Intronic
1134482929 16:14633941-14633963 AGACAATTCTCGGCCGGGCGCGG - Intronic
1134506203 16:14809304-14809326 ACAAAATTTCAGGCTGGGTGTGG - Intronic
1134543934 16:15093292-15093314 ACAAAAATCTAGGCCGGGCGCGG - Intronic
1134574347 16:15319460-15319482 ACAAAATTTCAGGCTGGGTGTGG + Intergenic
1134649200 16:15895269-15895291 AAAAACTTGTAGGCCGGGCGCGG + Intergenic
1134728068 16:16436838-16436860 ACAAAATTTCAGGCTGGGTGTGG - Intergenic
1134939368 16:18274988-18275010 ACAAAATTTCAGGCTGGGTGTGG + Intergenic
1135324281 16:21516346-21516368 AAGCTATTTTAGGCCGGGTGCGG + Intergenic
1135361510 16:21819442-21819464 ACAAAAATCTAGGCCGGGCGCGG - Intergenic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1135999378 16:27279761-27279783 AAACAATTCTGGGCCAGGTGCGG - Intronic
1136222809 16:28839296-28839318 AGAAAATTCTAGGCCAGGTGCGG + Intergenic
1136335766 16:29609623-29609645 AAGCTATTTTAGGCCGGGTGCGG + Intergenic
1136492500 16:30618470-30618492 ACACAAGCATAGGCTGGGTGTGG + Intronic
1136735380 16:32462149-32462171 AGACAAATGCAGGCCGGGCGCGG + Intergenic
1137309922 16:47245054-47245076 AAACATTTTTAGGCCGGGTGCGG + Intronic
1137454501 16:48608291-48608313 AAAACATTGTAGGCCGGGCGCGG - Intronic
1137850056 16:51732811-51732833 ATGCCATTGCAGGCCGGGTGCGG + Intergenic
1138004213 16:53315767-53315789 AAACAGTTATAGGCTGGGTGCGG - Intronic
1138068211 16:53964041-53964063 ATACATTGGTAGGCCGGGCGCGG - Intronic
1138138359 16:54544368-54544390 ACAGATTTTTAGGCCGGGCGCGG - Intergenic
1138464047 16:57174003-57174025 AAAAAATTCTCGGCCGGGTGCGG + Intronic
1138649827 16:58453494-58453516 TCACATTTGTGGGCCGGGTGTGG + Intergenic
1138669570 16:58602395-58602417 AACCATCTGTAGGCCGGGTGTGG + Intronic
1138969977 16:62132363-62132385 TAACAATTCCAGGCCGGGTGCGG - Intergenic
1139402516 16:66694417-66694439 AGGCAATTGCAGGCAGGGTGTGG + Intronic
1139532764 16:67551084-67551106 AAGCAATTGCAGGCCAGGTGCGG - Intergenic
1139539627 16:67604629-67604651 AAAAAATTGTTGGCCGGGTATGG - Intronic
1139813469 16:69643993-69644015 AAAGAATTTTAGGCTGGGTGTGG + Intronic
1139918732 16:70445261-70445283 AAAAAATTGAAGGCCGGGCGCGG - Intergenic
1140084511 16:71782451-71782473 TAATAATTGTAGGCTGGGTGCGG - Intronic
1140166021 16:72552472-72552494 ACACAAAAATGGGCCGGGTGTGG - Intergenic
1140189481 16:72803039-72803061 ACCCAGCTGTCGGCCGGGTGCGG + Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140293091 16:73682493-73682515 AAAGAAAGGTAGGCCGGGTGCGG + Intergenic
1140527651 16:75636928-75636950 AAAAAAATGCAGGCCGGGTGTGG - Intronic
1140576000 16:76169826-76169848 AACCAATTGTTGGCTGGGTGCGG + Intergenic
1141326024 16:83060082-83060104 ACGTAAAAGTAGGCCGGGTGCGG - Intronic
1141403892 16:83774662-83774684 AATAAATGGTAGGCCGGGTGTGG - Intronic
1141590403 16:85064973-85064995 ATACAATTATAGGCCGGGCGCGG - Intronic
1142068952 16:88078952-88078974 ACAAAAATTGAGGCCGGGTGCGG + Intronic
1142314790 16:89336833-89336855 AAACAACTGCAGGCCGGGCGCGG + Intronic
1142322002 16:89389313-89389335 GCAAAGTTGTAGGTCGGGTGTGG - Intronic
1203017700 16_KI270728v1_random:367442-367464 AGACAAATGCAGGCCGGGCGCGG - Intergenic
1203036035 16_KI270728v1_random:640600-640622 AGACAAATGCAGGCCGGGCGCGG - Intergenic
1142633964 17:1245152-1245174 ACACTGTTACAGGCCGGGTGCGG + Intergenic
1142718393 17:1760470-1760492 TTACAATTTTAGGCCGGGTGTGG - Intergenic
1142778388 17:2160507-2160529 AAACAATTGAAGGCCAGGCGCGG - Intronic
1142787351 17:2234551-2234573 AAATAATGGTAGGCCGGGTGCGG - Intronic
1142809673 17:2389563-2389585 AAACACTAGTAGGCCGGGCGCGG - Intronic
1142975858 17:3643855-3643877 AAAAAATTTTTGGCCGGGTGCGG - Intronic
1143009212 17:3856732-3856754 AAATTATTTTAGGCCGGGTGTGG - Intergenic
1143018936 17:3906419-3906441 GTACCATTGTTGGCCGGGTGCGG - Intronic
1143182524 17:4992572-4992594 AAACAAGTATAGGCCGGGTGCGG - Intronic
1143579125 17:7814692-7814714 ACACAAAAATTGGCCGGGTGTGG + Intronic
1143665145 17:8353436-8353458 ACCCAATCCTAGGCTGGGTGCGG - Intergenic
1143815859 17:9514312-9514334 ACAAAATGATAGGCTGGGTGCGG + Intronic
1144261559 17:13526941-13526963 CCACCACTGTGGGCCGGGTGCGG - Intronic
1144514891 17:15910587-15910609 ACATATTTGTAGGCCGGGCACGG - Intergenic
1144547363 17:16210091-16210113 ACCTATTTGTAGGCCAGGTGTGG + Intronic
1144567381 17:16371136-16371158 AATGAATTGTAGGCTGGGTGTGG - Intergenic
1144742670 17:17592634-17592656 CCCCTTTTGTAGGCCGGGTGTGG + Intergenic
1144751284 17:17650116-17650138 ATAAAATTGAAGGCTGGGTGAGG + Intergenic
1144845269 17:18214550-18214572 AAAAATTTGTAGGCCGGGCGTGG + Intergenic
1144869820 17:18362612-18362634 ATAACATTGTAGGCCGGGCGCGG - Intronic
1144963267 17:19058955-19058977 ACAGAAATGTAGGCCGGGCATGG + Intergenic
1144964423 17:19067085-19067107 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144971892 17:19115570-19115592 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1145015813 17:19397557-19397579 AAACAAGTTTAGGCTGGGTGTGG - Intergenic
1145042843 17:19589527-19589549 TCTCATTTTTAGGCCGGGTGTGG + Intergenic
1145092231 17:19995416-19995438 ACAAAAATGGGGGCCGGGTGTGG - Intergenic
1145098910 17:20057149-20057171 ACAGAAAGGTTGGCCGGGTGCGG + Intronic
1145232857 17:21187333-21187355 ACAAAACAGAAGGCCGGGTGCGG + Intronic
1145914057 17:28560486-28560508 ATACAAATATCGGCCGGGTGTGG + Intronic
1145981675 17:29016154-29016176 ATACAAATATAGGCCGGGCGCGG - Intronic
1146025010 17:29312576-29312598 AGACAGTGGTTGGCCGGGTGCGG - Intergenic
1146245844 17:31282090-31282112 ATACAATTTTGGGCCGGGCGTGG + Intronic
1146252984 17:31366222-31366244 AAAAAATTTTAGGCCAGGTGCGG - Intronic
1146391473 17:32427391-32427413 AGACAATTATGGGCCAGGTGTGG - Intergenic
1146769857 17:35558918-35558940 ACACAAACATAGGCTGGGTGTGG + Intergenic
1146913351 17:36662261-36662283 AAACAATACAAGGCCGGGTGCGG + Intergenic
1147006599 17:37408175-37408197 GCACAGTAGGAGGCCGGGTGCGG - Intronic
1147111133 17:38262526-38262548 ACACAATTATAGGCCGGGCACGG - Intergenic
1147220140 17:38923834-38923856 AAACAAAACTAGGCCGGGTGCGG + Intergenic
1147252549 17:39161804-39161826 AGACAATTACAGGCCAGGTGTGG - Intronic
1147410366 17:40246820-40246842 ACTCATTTGTTGGCCGGGCGTGG + Intronic
1147707661 17:42438298-42438320 AAACAATTCTGGGCCGGGAGCGG - Intergenic
1147735428 17:42634457-42634479 TCAACACTGTAGGCCGGGTGCGG - Intergenic
1147735843 17:42637616-42637638 AAGCAACTGTGGGCCGGGTGTGG + Intergenic
1148158863 17:45438710-45438732 ACACAAAAGTAAGCCAGGTGTGG - Intronic
1148418379 17:47525918-47525940 ACACAATTATAGGCCAGGCGCGG + Intronic
1148656398 17:49286889-49286911 AAACAAAAGTCGGCCGGGTGCGG + Intergenic
1148761551 17:50004724-50004746 ACACAAGAAGAGGCCGGGTGTGG + Intergenic
1148954195 17:51339870-51339892 AAAGAAATGTAGGCTGGGTGTGG - Intergenic
1149246467 17:54713756-54713778 AAATAATTGTAGGCCAGCTGCGG - Intergenic
1149258944 17:54858306-54858328 ACACAATTGGAGGCCGAGGGGGG - Intergenic
1149305859 17:55346015-55346037 AAACAAGTGTAGGCCGGGAGTGG + Intergenic
1149458169 17:56806262-56806284 AATCAACTGTAGGCCGGGTGCGG - Intronic
1149691685 17:58582545-58582567 AGAAATTTGCAGGCCGGGTGTGG - Intronic
1149749025 17:59127675-59127697 AAAAAATTGTGGGCTGGGTGTGG - Intronic
1149766514 17:59283316-59283338 AAACAAATGCAGGCCAGGTGCGG - Intergenic
1150324235 17:64243215-64243237 AAAAAATTTTTGGCCGGGTGTGG - Intronic
1150390217 17:64785792-64785814 ACACAAAAGTAAGCCAGGTGTGG - Intergenic
1150420705 17:65032818-65032840 ACACAGTATTAGGCTGGGTGCGG + Intronic
1150426081 17:65078189-65078211 AAACAACTGGTGGCCGGGTGCGG - Intergenic
1150476790 17:65481669-65481691 ATGCATTTATAGGCCGGGTGCGG - Intergenic
1150559716 17:66283970-66283992 ATGCAATTGAGGGCCGGGTGTGG - Intergenic
1150675119 17:67238389-67238411 AAATAATTTTAGGTCGGGTGCGG + Intronic
1151292134 17:73157857-73157879 AAACAATTGTGGGCCCGGCGTGG + Intergenic
1151511070 17:74560543-74560565 AAAAAAATGTAGGCCGGGTGCGG - Intergenic
1151544199 17:74782356-74782378 AAACAACTACAGGCCGGGTGTGG - Intronic
1151609373 17:75161878-75161900 AAAAAATTGTAGGCCGGGCACGG - Intronic
1152114910 17:78379533-78379555 AAATAATTCTTGGCCGGGTGTGG + Intronic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1152765537 17:82135811-82135833 GCACACTGGGAGGCCGGGTGGGG + Intronic
1153126012 18:1791035-1791057 AAAACATTTTAGGCCGGGTGCGG - Intergenic
1153205377 18:2693919-2693941 AAAAAATTGCAGGCCGGGCGTGG - Intronic
1153867084 18:9280496-9280518 ATGGACTTGTAGGCCGGGTGTGG + Intronic
1153874456 18:9355244-9355266 AGAAAACTTTAGGCCGGGTGTGG - Intronic
1154038569 18:10832005-10832027 ACAGAGTTGGAGGCCAGGTGCGG + Intronic
1154251008 18:12745033-12745055 AAAAAATTGTCGGCTGGGTGCGG - Intergenic
1154996247 18:21642978-21643000 AAACAATTTTTAGCCGGGTGTGG + Intergenic
1155079486 18:22393679-22393701 ACCTAATTGGAGACCGGGTGTGG - Intergenic
1155202015 18:23525711-23525733 AAAAAATTATAGGCCGGCTGTGG - Intronic
1155429570 18:25741585-25741607 ACTCAATTCCAGGCCGGGCGTGG + Intergenic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1156357440 18:36354509-36354531 ACAAAATTTTTGGCTGGGTGTGG + Intronic
1156405777 18:36781361-36781383 AAACCTCTGTAGGCCGGGTGCGG + Intronic
1156658761 18:39320387-39320409 ACACAATGGTAGGCAGTGGGAGG + Intergenic
1156875321 18:42003565-42003587 ACACACTTCTTGGCCAGGTGTGG - Intronic
1156884411 18:42117861-42117883 AAACACTTTGAGGCCGGGTGTGG - Intergenic
1157107401 18:44787562-44787584 AGAAAATTGTTGGCCGGGCGCGG + Intronic
1157237580 18:45978959-45978981 AAAAAATTGAAGGCCGGGTGAGG - Intergenic
1157309207 18:46539168-46539190 ACAGATTTGCAGGCCAGGTGTGG + Intronic
1158061170 18:53344727-53344749 ACTCAAATTTAGGCTGGGTGTGG - Intronic
1158131660 18:54158916-54158938 ACACATTTTTAGGCTGGGTTTGG - Intronic
1158276211 18:55770663-55770685 AAAAAAATTTAGGCCGGGTGCGG + Intergenic
1158277673 18:55786179-55786201 ACATACTTATAGGCTGGGTGTGG + Intergenic
1158364614 18:56719271-56719293 ACAGAATTGCTGGCCGGGCGCGG + Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1158657028 18:59346808-59346830 AGGCAAGAGTAGGCCGGGTGTGG - Intronic
1158686417 18:59618716-59618738 AAACTTTTCTAGGCCGGGTGTGG - Intronic
1158719134 18:59908340-59908362 ACACAAGTTCAGGCCGGGCGAGG - Intergenic
1158896982 18:61923433-61923455 ACACAAGAGAAGGCTGGGTGTGG - Intergenic
1158914852 18:62114069-62114091 AAAAAAATGTGGGCCGGGTGCGG + Intronic
1158940221 18:62400778-62400800 ACTAAATTATAGGCTGGGTGTGG - Intergenic
1159216184 18:65393509-65393531 ACATTATTTTAGGCCGGGCGAGG - Intergenic
1159342102 18:67148035-67148057 AAACAACTGGAGGCCGGGCGCGG - Intergenic
1159396446 18:67864329-67864351 ATACAACTGGAGGCCGGGCGCGG + Intergenic
1159510370 18:69390716-69390738 ATGTTATTGTAGGCCGGGTGTGG - Intergenic
1159742158 18:72185190-72185212 AAGCCACTGTAGGCCGGGTGCGG - Intergenic
1160275016 18:77423926-77423948 AAATAAATGTCGGCCGGGTGCGG + Intergenic
1160311720 18:77798403-77798425 ACAGAATTCTAGGTCAGGTGTGG - Intergenic
1160709804 19:545931-545953 ACAGAAATTAAGGCCGGGTGCGG - Intronic
1160804332 19:985323-985345 ATACAAATGTGGGCCGGGTGTGG - Intronic
1161044121 19:2125710-2125732 ACAGAAATGTAGGCCGGGCGCGG + Intronic
1161159115 19:2751948-2751970 AAAAAAATGTAGGCCGGGCGCGG + Intergenic
1161175297 19:2838903-2838925 AAAAAATTGAAGGCTGGGTGTGG + Intergenic
1161177661 19:2856493-2856515 AAATCATTTTAGGCCGGGTGTGG - Exonic
1161378709 19:3953306-3953328 AGAAAATTTCAGGCCGGGTGCGG - Intergenic
1161419247 19:4167050-4167072 AGACACTTATTGGCCGGGTGTGG + Intronic
1161530938 19:4788961-4788983 AAACAATTGGTGGCCAGGTGAGG + Intergenic
1161727558 19:5938892-5938914 AAACAATTATGGGCCAGGTGCGG + Intronic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1162073618 19:8169977-8169999 ACACAAAAGTTAGCCGGGTGTGG - Intronic
1162077589 19:8198478-8198500 AAATAATTTGAGGCCGGGTGCGG - Intronic
1162081701 19:8221814-8221836 ATAAAATTTTAGGCTGGGTGTGG - Intronic
1162354345 19:10172123-10172145 AAAGTATTTTAGGCCGGGTGTGG + Intronic
1162491937 19:10997755-10997777 ACACAGGTGAAGGCCAGGTGCGG - Intronic
1162557931 19:11399274-11399296 AAAAAAGTGTAGGCTGGGTGCGG + Intronic
1162665364 19:12205850-12205872 AAAGAAGTTTAGGCCGGGTGCGG - Intergenic
1162669398 19:12242215-12242237 AAAAAATTAAAGGCCGGGTGCGG + Intronic
1162737985 19:12757147-12757169 ACATAAAAATAGGCCGGGTGCGG + Intronic
1162862029 19:13513366-13513388 TCACCATAGTCGGCCGGGTGCGG + Intronic
1162984855 19:14263175-14263197 AAAAAATTTAAGGCCGGGTGCGG + Intergenic
1162985729 19:14268359-14268381 ATACAAATATAGGCCGGGCGTGG + Intergenic
1163082137 19:14951806-14951828 ACACAAAAACAGGCCGGGTGTGG - Intronic
1163110136 19:15155337-15155359 TGACAATTCTTGGCCGGGTGTGG - Intergenic
1163122980 19:15229087-15229109 AAACAATAATAGGCTGGGTGCGG + Intronic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163528827 19:17837703-17837725 AAAAAATTTTAGGCCGGGCGCGG - Intronic
1163581468 19:18141844-18141866 AAAGAATGGTAAGCCGGGTGCGG - Intronic
1163729864 19:18942578-18942600 ACTCAAGTGTCGGCCAGGTGTGG - Intergenic
1163759602 19:19128518-19128540 AAAAAAATGTAGGCCAGGTGTGG - Intronic
1163865069 19:19766632-19766654 ACAGAATTATAGGTCGGGTGTGG + Intergenic
1163995285 19:21039754-21039776 AAGCAAAAGTAGGCCGGGTGCGG - Intronic
1164037120 19:21465110-21465132 ACAAAATAATAGGCCGGGCGTGG + Intronic
1164102461 19:22069322-22069344 AAACAATATTAGGCCGGGCGTGG + Intronic
1164644209 19:29845861-29845883 AGAGAATTGTGGGTCGGGTGGGG - Intergenic
1164980456 19:32609883-32609905 ACACCACTGGAGACCGGGTGTGG + Intronic
1164980590 19:32610822-32610844 ACACCACTGGAGGCCTGGTGTGG + Intronic
1165226482 19:34358775-34358797 ACAGAACTAGAGGCCGGGTGCGG + Intergenic
1165341230 19:35213709-35213731 ACAAAATTCTTGGCCGGGCGCGG - Intergenic
1165352881 19:35285988-35286010 ACATCTTTGTAGGCCGGGCGTGG - Intergenic
1165450706 19:35880523-35880545 AAAAAATTTTAGGCCAGGTGCGG + Intergenic
1165668252 19:37652825-37652847 AGAAAATTGTGGGCCAGGTGCGG + Intronic
1165682284 19:37788379-37788401 ACAAAATTTTTGGCCGGGCGCGG + Intronic
1165769795 19:38372861-38372883 ACAAAAATGATGGCCGGGTGTGG - Intergenic
1165892580 19:39123087-39123109 ACAACATTCTAGGCTGGGTGTGG + Intergenic
1166006001 19:39906966-39906988 ACATAATAGAAGGCTGGGTGTGG - Intronic
1166040543 19:40199866-40199888 ACTCCTTTGGAGGCCGGGTGCGG + Intronic
1166089793 19:40501376-40501398 AAACAAATATAGGCCAGGTGCGG + Intronic
1166132197 19:40752450-40752472 ACCCAATTTTTGGCCGGGCGTGG + Intronic
1166132357 19:40753685-40753707 AAACATATGCAGGCCGGGTGTGG - Intronic
1166288446 19:41846855-41846877 AAAAATTTTTAGGCCGGGTGCGG - Intronic
1166796027 19:45426666-45426688 CCAGAATTCTAGGCTGGGTGCGG + Intronic
1166845504 19:45725447-45725469 AAACACTTGTGGGCCAGGTGCGG + Intronic
1166861098 19:45811724-45811746 ATACAAATGTTGGCCAGGTGCGG - Intronic
1167256747 19:48434869-48434891 AAACAATTCCAGGCTGGGTGCGG - Intronic
1167445716 19:49536274-49536296 AAAAAAAAGTAGGCCGGGTGCGG - Intronic
1167497457 19:49827937-49827959 CAACAAATGTCGGCCGGGTGTGG + Intronic
1167588104 19:50386426-50386448 ACATGAGTTTAGGCCGGGTGTGG - Intronic
1167844842 19:52153726-52153748 ACATACTAGAAGGCCGGGTGTGG - Intergenic
1167899523 19:52608977-52608999 AAAAAATTGTAGGCTGGGCGTGG + Intronic
1167927041 19:52829662-52829684 AAACAATGGATGGCCGGGTGCGG - Intronic
1167950877 19:53026719-53026741 AAAAAAGTGTAGGCCAGGTGTGG + Intergenic
1167964172 19:53129907-53129929 ACACAAAAGTTAGCCGGGTGTGG + Intronic
1168032013 19:53687853-53687875 ATACAAATGTAGGCCAGGTGTGG - Intergenic
1168044515 19:53784823-53784845 ATACAAACGTTGGCCGGGTGCGG + Intergenic
1168080831 19:54008996-54009018 AAGCAATTATAGGCCGGGTGCGG + Intronic
1168135205 19:54346383-54346405 AAACAAGAATAGGCCGGGTGCGG + Intergenic
1168210275 19:54885094-54885116 AAAAAAATTTAGGCCGGGTGCGG - Intronic
1168211385 19:54893252-54893274 AAAAAATTGTAGGCCAGGCGTGG - Intergenic
1168219277 19:54948827-54948849 AAACAATTTTAGGCCAGGTGCGG - Intronic
1168384214 19:55949526-55949548 ATACATATCTAGGCCGGGTGTGG - Intronic
1168483341 19:56739875-56739897 AGCCAACTGTTGGCCGGGTGCGG - Intergenic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
1168505482 19:56930377-56930399 AAAAAATTGTGGGCTGGGTGTGG - Intergenic
1168558202 19:57361431-57361453 ATAAAAATGAAGGCCGGGTGCGG - Intergenic
1168606888 19:57767415-57767437 ACAAAAAAGTTGGCCGGGTGCGG - Intergenic
1168708472 19:58483200-58483222 AAATAATAGTAGGCTGGGTGTGG + Intronic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
925227864 2:2201407-2201429 TCATAAGTGTTGGCCGGGTGCGG + Intronic
925320441 2:2962370-2962392 ATATAATTGTAGGCCAGGCGTGG + Intergenic
925457634 2:4029669-4029691 ACACATAATTAGGCCGGGTGTGG + Intergenic
925635694 2:5939959-5939981 ACACAAAAGGAGGCCGGGTGAGG + Intergenic
926057375 2:9781986-9782008 ACTGAGTTGTTGGCCGGGTGAGG - Intergenic
926183239 2:10664823-10664845 ACACAAATGTTGGCTGGGTGTGG - Intronic
926186666 2:10696196-10696218 ATACAAGTGTAGGCCGGGTGCGG - Intergenic
926264293 2:11300552-11300574 CCATAGTTGTTGGCCGGGTGTGG - Intronic
926529723 2:14028941-14028963 ACTCAACTTGAGGCCGGGTGCGG - Intergenic
926748877 2:16182287-16182309 ATACAATTGGAGGCGGGGGGAGG + Intergenic
926849565 2:17180098-17180120 ATTCTATTTTAGGCCGGGTGTGG - Intergenic
926872662 2:17440474-17440496 ACATCATTCAAGGCCGGGTGCGG + Intergenic
926952806 2:18261783-18261805 TGCCCATTGTAGGCCGGGTGCGG - Intronic
927533243 2:23830272-23830294 AAACTATTTTAGGCTGGGTGTGG - Intronic
927665622 2:25030433-25030455 AAAGAATTGTAGGCTGGGCGTGG + Intergenic
927900298 2:26814033-26814055 ACAGAATTCCAGGCCGGGCGCGG + Intergenic
927907212 2:26867743-26867765 AAACAATTGGGGGCCGGGCGCGG - Intronic
927985987 2:27410744-27410766 AAACAATAGTAGGCGGGGTGCGG - Intergenic
928329214 2:30344839-30344861 TAACAATTTTTGGCCGGGTGCGG + Intergenic
928526649 2:32148379-32148401 AGAAAATTACAGGCCGGGTGCGG + Intronic
928574634 2:32642541-32642563 AAACAAATTTAGGCCAGGTGCGG - Intronic
928587768 2:32778931-32778953 GTACCATTTTAGGCCGGGTGTGG + Intronic
929118301 2:38463421-38463443 ACAGAATTGGGGGCCGGGCGTGG - Intergenic
929173158 2:38951474-38951496 ATATATTTGTGGGCCGGGTGTGG + Intronic
929325332 2:40603695-40603717 AAATAAATGTAGGCTGGGTGCGG + Intronic
929590369 2:43141843-43141865 AAACATTTGCGGGCCGGGTGCGG - Intergenic
929702658 2:44177706-44177728 ACATACATGTAGGCCGGGCGCGG - Intronic
929739137 2:44584762-44584784 AAAAAATAGTAGGCCGGGTGCGG + Intronic
929749410 2:44694281-44694303 AAATAATTCTAGGCCAGGTGCGG + Intronic
930474487 2:51864002-51864024 AGAAAATAGTAGGCCAGGTGCGG + Intergenic
930567746 2:53043921-53043943 ACACTATTTAAGGCCAGGTGTGG - Intergenic
930632699 2:53771222-53771244 ATAAAACTATAGGCCGGGTGCGG + Intronic
930756746 2:54982244-54982266 TCATACTTGTGGGCCGGGTGTGG - Intronic
930811485 2:55546416-55546438 AGAAACTTGCAGGCCGGGTGTGG + Intergenic
931278401 2:60764714-60764736 AAAGAATTCTAGACCGGGTGTGG - Intronic
931278465 2:60765369-60765391 AGAGAATTATAGGCTGGGTGTGG - Intronic
931397648 2:61902119-61902141 AGTCAAATCTAGGCCGGGTGCGG - Intronic
931605231 2:64045827-64045849 AGTCAAATATAGGCCGGGTGCGG - Intergenic
931616454 2:64163666-64163688 ATATAATTATAGGCTGGGTGCGG - Intergenic
931654953 2:64502475-64502497 ACAAAATTGTGGGCCGGGCACGG + Intergenic
931982693 2:67711332-67711354 AAAAAATTTTAGGCCAGGTGCGG + Intergenic
932154547 2:69404126-69404148 AATTAATTGGAGGCCGGGTGCGG - Intronic
932240841 2:70155506-70155528 ATACAAAATTAGGCCGGGTGTGG + Intronic
932726096 2:74181061-74181083 ACACAGATTTAGGCCGGGCGAGG + Intergenic
932898744 2:75673018-75673040 ACACTATAGTTGGCCGGGCGCGG + Intronic
932979508 2:76647336-76647358 TAAGAATTGTAGGCCGGGCGCGG - Intergenic
933205655 2:79504578-79504600 ATTAAATTGTAGGTCGGGTGCGG - Intronic
933703898 2:85275625-85275647 AGACCAGTGTAGGCCAGGTGCGG + Intronic
934649008 2:96077628-96077650 AAAAAATTCTAGGCTGGGTGTGG - Intergenic
934750430 2:96790294-96790316 AAAAAATTCTAGGCCGGGTGCGG - Intronic
934960206 2:98666400-98666422 TCAGAATTTAAGGCCGGGTGTGG + Intronic
935040971 2:99426891-99426913 AAAAAATTGCTGGCCGGGTGCGG + Intronic
935154914 2:100475707-100475729 AGAAAAAAGTAGGCCGGGTGTGG + Intronic
935226367 2:101056484-101056506 AAATAATTCTAGGCCGGGCGCGG - Intronic
935678120 2:105613643-105613665 ACACAATTATGGGCCGGTGGGGG - Intergenic
935743728 2:106173269-106173291 AGAAAACTGTAGGCTGGGTGTGG + Intronic
935789373 2:106577063-106577085 ACACAACCTTAGGCCGGGCGCGG - Intergenic
936102920 2:109599165-109599187 ACTCAAGTGGAGGCCGGGCGCGG + Intronic
936246437 2:110832246-110832268 ACAAACTAGTAGGCCGGGCGCGG + Intronic
936445963 2:112595495-112595517 ACAAAAATGAAGGCAGGGTGTGG - Intergenic
936562338 2:113551861-113551883 ACACAAATGTGTGCCGGGAGGGG - Intergenic
937103885 2:119292742-119292764 ATACAATCTTAGGCCAGGTGCGG + Intergenic
937213763 2:120296977-120296999 ACATAATTTTAGGCCGGGTGTGG - Intergenic
937293329 2:120795076-120795098 ATAAAATTCTAGGCCGAGTGTGG + Intronic
937306695 2:120876049-120876071 AAATAAATGCAGGCCGGGTGCGG + Intronic
937401694 2:121589337-121589359 ATACCACTATAGGCCGGGTGCGG + Intronic
937954033 2:127409036-127409058 AAATTATTGTAGGCCGGGAGCGG + Intergenic
938270936 2:129970726-129970748 ATATAACTTTAGGCCGGGTGCGG + Intergenic
938783347 2:134604887-134604909 ACACAATCCTTGGCCAGGTGCGG + Intronic
938897751 2:135768990-135769012 AAACAAATGGAGGCTGGGTGTGG - Intronic
939869270 2:147508790-147508812 ACACAGTTTCAGGCTGGGTGCGG + Intergenic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
940209594 2:151242774-151242796 ACAAAAATGTAGGGCAGGTGTGG - Intergenic
940257120 2:151743004-151743026 CAAAAATTGCAGGCCGGGTGTGG - Intergenic
940276326 2:151944499-151944521 TTACAACTGAAGGCCGGGTGTGG + Intronic
941337001 2:164258550-164258572 AGTTAACTGTAGGCCGGGTGTGG + Intergenic
941644911 2:168029948-168029970 TCCCAATTTTGGGCCGGGTGCGG + Intronic
941779040 2:169425262-169425284 ATATAATTGTTGGCCGGGCGCGG + Intergenic
941819499 2:169829712-169829734 ACTCAAATGTTGGCCGGGCGCGG - Intronic
941882677 2:170497324-170497346 ACACAAGTCTAGGCCAGGGGCGG + Intronic
941935202 2:170976245-170976267 ATACAAATTTAGGCTGGGTGTGG + Intergenic
942054020 2:172165973-172165995 ACAAAAACCTAGGCCGGGTGCGG + Intergenic
942537310 2:176978548-176978570 ACCCAACTTTAGGCCTGGTGTGG + Intergenic
942554362 2:177156498-177156520 AAACAATTCTAGGCTGGGTGAGG - Intergenic
942795124 2:179808320-179808342 TAAAAATTATAGGCCGGGTGCGG - Intronic
943604155 2:189956457-189956479 ATATACTAGTAGGCCGGGTGCGG - Intronic
943694839 2:190915288-190915310 ATACAAATTTAGGCCGGGCGCGG - Intronic
943959382 2:194242055-194242077 AAAGAATTATAGGCCGGGTGCGG + Intergenic
944253765 2:197603623-197603645 ATAGAACTTTAGGCCGGGTGTGG + Intronic
944361581 2:198863170-198863192 AAACAATTTTCGGCCGGGCGCGG - Intergenic
944457804 2:199912929-199912951 AAACACATGTAGGCCGGGCGCGG - Intronic
944731133 2:202518426-202518448 AAACCATTCTAGGCTGGGTGTGG - Intronic
944756939 2:202772912-202772934 AACCAATTATAGGCCGGGTGAGG - Intergenic
944799114 2:203219563-203219585 CCAAAAATGTGGGCCGGGTGTGG + Exonic
945077520 2:206054802-206054824 AAACAAAAATAGGCCGGGTGTGG - Intronic
945280288 2:208029404-208029426 AGACAAAAGAAGGCCGGGTGCGG - Intergenic
945298236 2:208192116-208192138 ACTAAACTGTAGGCTGGGTGTGG + Intergenic
945420166 2:209626125-209626147 AAAATATTATAGGCCGGGTGTGG + Intronic
945755674 2:213843558-213843580 ACACCCTTCTAGGCCGGGCGAGG + Intronic
945914327 2:215686844-215686866 ACAAAACTGTTGGCCGGGTGCGG - Intergenic
945980057 2:216302605-216302627 ATGGAATTTTAGGCCGGGTGTGG + Intronic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946381219 2:219350420-219350442 ACACAACTGAAGGCTGCGTGGGG + Intergenic
946663631 2:222027544-222027566 AAAGCAATGTAGGCCGGGTGTGG + Intergenic
946925655 2:224624343-224624365 ACACAAAAGTAGGCCAGGGGCGG - Intergenic
947168932 2:227291271-227291293 AAACACTTGTCGGCCGGGCGCGG + Intronic
947203350 2:227637040-227637062 AAGCAATTGCAGGCTGGGTGCGG + Intergenic
947486204 2:230551490-230551512 AAAAAAATGTAGGCCGGGCGAGG + Intergenic
947554527 2:231079083-231079105 AAAGGATTTTAGGCCGGGTGCGG - Intronic
947789519 2:232856220-232856242 AAAGAACTGCAGGCCGGGTGTGG - Intronic
947987768 2:234463562-234463584 ATACAATTTTAGGCCAGGCGCGG - Intergenic
948044611 2:234934056-234934078 ATACATTTTTAGGCTGGGTGCGG - Intergenic
948447615 2:238045131-238045153 ATAAAAGTGAAGGCCGGGTGCGG - Intronic
1168748086 20:261909-261931 ACACATTCATAGGCCGGGCGCGG + Intergenic
1168768632 20:399279-399301 CCACAATGATTGGCCGGGTGCGG - Intergenic
1169139333 20:3218206-3218228 AACCAACTGTAGGCCGGGCGTGG - Intronic
1169244128 20:4012120-4012142 AAACAATTATTGGCCGGGCGCGG + Intronic
1169260984 20:4137715-4137737 AAATAATATTAGGCCGGGTGTGG + Intronic
1169314743 20:4580727-4580749 TCAAAATTGTTGGCCGGATGCGG + Intergenic
1169331322 20:4718743-4718765 ACATAATGCTGGGCCGGGTGTGG + Intergenic
1169549748 20:6690513-6690535 AAACATCTATAGGCCGGGTGCGG + Intergenic
1170101876 20:12710195-12710217 TGACATTTGTAGGCCGGGCGCGG - Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1170257932 20:14366653-14366675 CAAAAATTGTTGGCCGGGTGTGG - Intronic
1170625813 20:18029317-18029339 ATACATATGTAGGCCGGGCGTGG - Intronic
1170646053 20:18196844-18196866 ACAAAAAATTAGGCCGGGTGCGG - Intergenic
1170879610 20:20284573-20284595 AGCCAATTGAAGGCCGGGCGCGG - Intronic
1170966793 20:21080501-21080523 AATCAATTGAAGGCTGGGTGTGG - Intergenic
1171561516 20:26130997-26131019 ACCTATTTGTAGGCTGGGTGCGG + Intergenic
1171934531 20:31261214-31261236 ACACAATTTTTGGGGGGGTGGGG - Intergenic
1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG + Intergenic
1172078432 20:32317929-32317951 ACAGTATTGTGGGCTGGGTGTGG - Intronic
1172103382 20:32499446-32499468 AAACAATTTTTGGCTGGGTGTGG + Intronic
1172346601 20:34206284-34206306 ATACAATTCGAGGCCGGGCGTGG - Intronic
1172826100 20:37787632-37787654 ACACAGTTATGGGCCGGGCGCGG - Intronic
1172984451 20:38972299-38972321 AAGAAATTATAGGCCGGGTGAGG - Intronic
1173289261 20:41700218-41700240 AAATATTTGTAGGCCGGGCGGGG - Intergenic
1173475469 20:43356123-43356145 ACGCAATTCTAGGCCGGGTGCGG + Intergenic
1173513455 20:43648444-43648466 ACAAATTTGTAGGCCGGGCGCGG - Intergenic
1173516769 20:43669833-43669855 ACAGCATTGGAGGCTGGGTGTGG + Intronic
1173816001 20:45988452-45988474 AAACATTTCTAGGCCAGGTGTGG - Intergenic
1174030332 20:47619352-47619374 AAAGAAATGTAGGCTGGGTGTGG + Intronic
1174226928 20:49008270-49008292 TCACAATGTTTGGCCGGGTGTGG + Intronic
1174350093 20:49960956-49960978 ACACATTTTTTGGCCAGGTGTGG - Intergenic
1174445588 20:50588788-50588810 AAAGAATTCTAGGCCGGGCGCGG + Intronic
1174504380 20:51007474-51007496 AAACAATTTTAGGCCACGTGTGG - Intronic
1174617953 20:51850957-51850979 ACACATTTTAAGGCCGGGCGTGG + Intergenic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174709993 20:52694504-52694526 AGACTATAGTAGGCTGGGTGCGG + Intergenic
1174799949 20:53555016-53555038 AAACATTTGAAGGCTGGGTGTGG - Intergenic
1174826944 20:53777000-53777022 ACAAAAATTTAGGCCAGGTGCGG + Intergenic
1175152914 20:56949154-56949176 ATAGAAATGTAGGCTGGGTGCGG - Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175287625 20:57847800-57847822 AGAAAATTGTAGGCTGGGTGCGG - Intergenic
1175345398 20:58269243-58269265 ACACAATGGGAAGCTGGGTGCGG + Intergenic
1175982861 20:62749149-62749171 ATGAAATTGTAGGCCGGGCGCGG + Intronic
1176004887 20:62855958-62855980 ACCCAATTATAGGCCGGGTGTGG + Intronic
1176274924 20:64259678-64259700 ATTCAAATTTAGGCCGGGTGCGG - Intronic
1176782083 21:13208418-13208440 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1176896991 21:14391400-14391422 AAACAATAGTTGGCCGGGTCCGG - Intergenic
1177494735 21:21873808-21873830 ACCAAATAGTAGGCCTGGTGCGG + Intergenic
1177617751 21:23546039-23546061 ACACAATTTATGGCCGGGCGTGG + Intergenic
1178273846 21:31218275-31218297 TCTCAAATGTAGGCCAGGTGCGG + Intronic
1178287519 21:31337818-31337840 AAATAATAATAGGCCGGGTGTGG - Intronic
1178467734 21:32863910-32863932 TCACACTTGTAAGCCGGGTGCGG + Intergenic
1178511594 21:33209803-33209825 ATACATTTTTAGGCCAGGTGCGG + Intergenic
1178589942 21:33901386-33901408 AAATCATTGTAGGCTGGGTGTGG + Intronic
1178866705 21:36334075-36334097 ATATTTTTGTAGGCCGGGTGCGG - Intronic
1178962948 21:37084702-37084724 ACAAAATACAAGGCCGGGTGCGG + Intronic
1179020404 21:37635506-37635528 ACAAAATAATAGGCCAGGTGCGG - Intronic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179382617 21:40913244-40913266 ACATGATTTTAGGCCGGGCGCGG - Intergenic
1179769937 21:43606994-43607016 ACAGAACTGGAGGCCAGGTGTGG + Intronic
1179830545 21:43993586-43993608 ACACACTCGGAGGCAGGGTGTGG - Intergenic
1180097614 21:45565884-45565906 AAACAATTCCCGGCCGGGTGCGG + Intergenic
1180431971 22:15261439-15261461 TAACAAATGCAGGCCGGGTGTGG - Intergenic
1180681360 22:17629073-17629095 ACATGATTGTTGGCCGGGCGTGG + Intronic
1181101611 22:20544373-20544395 ACAGAAATTTAGGCCGGGTGCGG + Intronic
1181159594 22:20950702-20950724 ACACAAGTCTAGGCCAGGCGCGG - Exonic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181578671 22:23814118-23814140 TCAAAATTGCTGGCCGGGTGTGG - Intronic
1181628080 22:24134785-24134807 AAACAAGTGTGGGCCGGGCGCGG + Intronic
1181746488 22:24958357-24958379 AAACAATTTAAGACCGGGTGAGG + Intronic
1182139487 22:27941007-27941029 AAAAATTTGTAGGCCGGATGTGG - Intergenic
1182328733 22:29534976-29534998 AAAGCATTTTAGGCCGGGTGTGG + Intronic
1182509906 22:30811708-30811730 ACACAAAAATTGGCCGGGTGTGG - Intronic
1182514099 22:30843072-30843094 ACTGAATTGCAGGCCGGGTGCGG - Intronic
1182600195 22:31456511-31456533 AAAAAATAGTAGACCGGGTGTGG - Intronic
1183157152 22:36084435-36084457 ACATAATTGCTGGCAGGGTGTGG - Intergenic
1183207445 22:36429230-36429252 ATAAATTTGTAGGCCAGGTGCGG + Intergenic
1183219821 22:36505476-36505498 ATAGAATTGAAGGCCGGGTGCGG + Intronic
1183233819 22:36600835-36600857 AAAAAATTTTAGGCCGGGAGCGG - Intronic
1183458465 22:37935547-37935569 AAAAAATAATAGGCCGGGTGCGG - Intronic
1183607863 22:38877076-38877098 AGAAAGTTGTTGGCCGGGTGCGG - Intergenic
1184014727 22:41777444-41777466 ATATAATTTTAGGCCGAGTGTGG - Intronic
1184295513 22:43521742-43521764 ATTCAGTTTTAGGCCGGGTGCGG - Intergenic
949355520 3:3176578-3176600 ACACAAAAGTTAGCCGGGTGTGG + Intronic
950218990 3:11180051-11180073 ACACAAAAGAGGGCCGGGTGTGG - Intronic
950286001 3:11745151-11745173 AATTATTTGTAGGCCGGGTGTGG - Intergenic
950389480 3:12685159-12685181 ACATAATACCAGGCCGGGTGCGG - Intergenic
950574154 3:13821163-13821185 ACACAATTGGGGGCAGAGTGAGG + Intronic
950699437 3:14730255-14730277 AATCGATTTTAGGCCGGGTGCGG + Intronic
950937220 3:16851434-16851456 ATACAATAGTAAGCTGGGTGCGG + Intronic
951099206 3:18667317-18667339 AAAAAATTCTTGGCCGGGTGCGG + Intergenic
951371135 3:21850032-21850054 AAACAATTTTAGGCTGAGTGTGG - Intronic
951402263 3:22247891-22247913 TAAAAATTGTAGGCCGGGCGTGG - Intronic
951718974 3:25678364-25678386 AGAAAATTCCAGGCCGGGTGTGG - Intergenic
951764316 3:26180054-26180076 AGAAAAATGTAGGCCGGGTGCGG - Intergenic
952031383 3:29147000-29147022 ACAATATTGTAGGCCGGGCATGG + Intergenic
952046450 3:29327018-29327040 AAAGGATTCTAGGCCGGGTGTGG - Intronic
952475080 3:33700553-33700575 AATCAATTGTGGGCCAGGTGCGG + Intronic
952524513 3:34196269-34196291 AAAACATTATAGGCCGGGTGCGG + Intergenic
952662066 3:35863744-35863766 ACAAAAATGTAGGCTGGGTGCGG - Intergenic
952802473 3:37308958-37308980 TAACAATTATAGGCCGGGTGTGG + Intronic
952935900 3:38398106-38398128 ACATAAGCTTAGGCCGGGTGCGG - Intronic
953055184 3:39382255-39382277 AAAAAATTACAGGCCGGGTGCGG - Intergenic
953504908 3:43475890-43475912 ACAAATTTGTAGGCCAGGTGTGG - Intronic
953585186 3:44193691-44193713 ACTCCATTTTAGGCTGGGTGCGG - Intergenic
953976302 3:47384176-47384198 AAGTATTTGTAGGCCGGGTGCGG + Intronic
954020330 3:47735043-47735065 AAAAAATTGAAGGCCGGGCGTGG - Intronic
954069688 3:48133921-48133943 ATACAAAATTAGGCCGGGTGCGG - Intergenic
954166171 3:48760065-48760087 ACAAAAATGTAGGCCAGGTGTGG + Intronic
954187719 3:48931724-48931746 TCACAATTTTCAGCCGGGTGCGG + Intronic
954238358 3:49274483-49274505 AAACAAATGCAGGCTGGGTGAGG - Intronic
954267836 3:49483942-49483964 AGACACTTCTGGGCCGGGTGTGG - Intronic
954381795 3:50222868-50222890 AAATAGTTCTAGGCCGGGTGTGG + Intergenic
954454378 3:50589604-50589626 AAATAATTTTAGGCCGGGCGCGG + Intergenic
954470872 3:50693976-50693998 ACAAAATTGTTGGCCAAGTGTGG + Intronic
955235578 3:57136292-57136314 ACACATATGTAGCCCAGGTGTGG + Intronic
955301784 3:57787024-57787046 ACATAATTTTCGGCAGGGTGCGG - Intronic
955323642 3:57992969-57992991 ACAGACTTGTAGGCTGGGCGCGG + Intergenic
955740042 3:62080965-62080987 ACATAATTAGAGGCCGGGCGCGG + Intronic
955772249 3:62396939-62396961 TTAAAATTGTAGGCCGGGTGCGG + Intergenic
956411255 3:68982227-68982249 ATGAAATTTTAGGCCGGGTGTGG + Intronic
956443958 3:69307627-69307649 AAGAAATAGTAGGCCGGGTGTGG - Intronic
956538448 3:70306399-70306421 AAACGATTATTGGCCGGGTGAGG - Intergenic
957459290 3:80496704-80496726 ACACCCTTGTAGGCCAGCTGTGG + Intergenic
957858383 3:85909012-85909034 TCACAACTGTAGGCCGGGCGTGG - Intronic
957968083 3:87346684-87346706 ACAGAAGTATAGGTCGGGTGTGG + Intergenic
958020314 3:87986812-87986834 ACACCATTGCAGGCCGGGCATGG + Intergenic
958042088 3:88238965-88238987 AGCCAATTTTAGGCCAGGTGCGG + Intergenic
958649304 3:96917128-96917150 ACACATTTTTTGGCCGGGTGTGG + Intronic
958657852 3:97025876-97025898 ACTTAAATGTAGGCCAGGTGTGG - Intronic
958820653 3:98969985-98970007 ACACAGGTTGAGGCCGGGTGCGG - Intergenic
959465883 3:106686544-106686566 AAACAATTGTAGTCTGGATGAGG + Intergenic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
959697103 3:109260309-109260331 ACACACTAGTAGGCCGGGCATGG + Intergenic
960107675 3:113815678-113815700 ACAGGAGGGTAGGCCGGGTGCGG + Intergenic
960307258 3:116076545-116076567 AAATAATTATTGGCCGGGTGTGG - Intronic
960399383 3:117177571-117177593 AAAAAATAGCAGGCCGGGTGCGG - Intergenic
960651481 3:119955941-119955963 ACACATTAGTGGGCTGGGTGAGG - Intronic
960666205 3:120111522-120111544 ACACACTTCTCGGCCGGGCGCGG + Intergenic
961099876 3:124189647-124189669 ACAAAATATTAGGCCAGGTGCGG + Intronic
961731348 3:128967409-128967431 ACCCAAGGGTAGGCCGGGTACGG + Exonic
961845909 3:129762906-129762928 ATACCATTATAGGCCGGGCGCGG + Intronic
962135315 3:132725428-132725450 AAAAAATGGCAGGCCGGGTGCGG - Intergenic
963143713 3:141970769-141970791 ACATCATGGTAGGCTGGGTGTGG + Intronic
963675926 3:148311523-148311545 AAACAATTACTGGCCGGGTGCGG + Intergenic
963818689 3:149863668-149863690 GAACAAATGTAGCCCGGGTGTGG - Intronic
964110309 3:153080414-153080436 ACATAATTTTGGGCCGGGCGCGG - Intergenic
964348742 3:155781785-155781807 AAAAAATAGTGGGCCGGGTGCGG + Intronic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
965537941 3:169843482-169843504 ACAGAACTGTGAGCCGGGTGAGG + Intronic
965581542 3:170273522-170273544 AGACAACTGTGGGCTGGGTGCGG + Intronic
965581590 3:170273839-170273861 AGACAACTGTGGGCTGGGTGTGG + Intronic
965885071 3:173435542-173435564 AAAAAAATGTAGGCTGGGTGCGG + Intronic
965970690 3:174552502-174552524 AATCAATAATAGGCCGGGTGTGG + Intronic
966025590 3:175276591-175276613 ATACATTTGCAGGCTGGGTGTGG - Intronic
966170928 3:177079139-177079161 AAAAAAATGTCGGCCGGGTGCGG + Intronic
966192642 3:177285306-177285328 AAAGAATTTTAGGCAGGGTGTGG - Intergenic
966276176 3:178172830-178172852 TAAGAATTCTAGGCCGGGTGTGG + Intergenic
966295441 3:178415691-178415713 AGACATTAATAGGCCGGGTGCGG + Intergenic
966358189 3:179104545-179104567 AAATAATTGCCGGCCGGGTGCGG + Intergenic
966379667 3:179331486-179331508 GCACAACTTTAGGCCAGGTGCGG + Intronic
966867293 3:184266001-184266023 AAAAAAATATAGGCCGGGTGTGG + Intronic
966943083 3:184759210-184759232 ACTCATTTGTAGGCTGGGCGTGG + Intergenic
966973967 3:185069248-185069270 ACACACAGATAGGCCGGGTGGGG - Intergenic
967028486 3:185584842-185584864 ACAGCATTCCAGGCCGGGTGTGG - Intronic
967071232 3:185963989-185964011 ATGCAAATGAAGGCCGGGTGTGG + Intergenic
967074821 3:185992567-185992589 ACACTATTGTTGGCGGGGCGCGG - Intergenic
967402051 3:189074492-189074514 AAACAATTCTGGGCCGGGCGCGG - Intronic
967430702 3:189381853-189381875 ACTCAAATCTAGGCCGGGCGTGG - Intergenic
967871383 3:194232659-194232681 CAATAATTGTAGGCCAGGTGTGG + Intergenic
968171394 3:196512796-196512818 ATACATCTCTAGGCCGGGTGCGG - Intronic
968209530 3:196837081-196837103 AAACAATTCTTGGCTGGGTGTGG - Intergenic
968246274 3:197152484-197152506 ACTCAAGTTTAGGCCGGGTGCGG + Intronic
968293733 3:197557452-197557474 AGAAAACTGTAGACCGGGTGCGG + Intronic
968477059 4:816372-816394 ACACAAAAGTTAGCCGGGTGTGG - Intronic
968720546 4:2199865-2199887 ACTCAACTGTTGGCTGGGTGTGG - Intronic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
968865922 4:3211192-3211214 AAACAATTTTAGGCCGGGCGTGG - Intronic
969366955 4:6701416-6701438 AAAGAATTATAGGCCGGGCGCGG - Intergenic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
969602936 4:8187838-8187860 ACAAATATGTAGGCCGGATGCGG - Intronic
970328660 4:14956054-14956076 ATAAAATGGTAGGCTGGGTGCGG + Intergenic
970594874 4:17591057-17591079 ACAAAAGTTTAGGCTGGGTGTGG - Intronic
970598661 4:17623108-17623130 AAATAAACGTAGGCCGGGTGTGG + Intronic
970992597 4:22230154-22230176 AGAAAATTCTAGGCCGGGAGCGG + Intergenic
972275594 4:37554636-37554658 AAATATTTCTAGGCCGGGTGTGG - Intronic
972303907 4:37813163-37813185 ACACTTTTCTAGGCTGGGTGTGG + Intergenic
972377362 4:38485417-38485439 AAATAATTGTAGGCCAGGCGCGG - Intergenic
972499287 4:39662491-39662513 AAAAAATTATAGGCCGGGCGTGG - Intergenic
972609588 4:40644348-40644370 AAAAAATTTTAGGCCAGGTGCGG + Intergenic
972633199 4:40859493-40859515 ACACTACTGCAGGCCGGGTGCGG - Intronic
972664620 4:41152616-41152638 AAACAAGTGAAGGCCGGGCGCGG - Intronic
972672373 4:41226101-41226123 AGTCAATTTTAGGCCGGGTGCGG + Intergenic
973050668 4:45592123-45592145 AAACATTTATAGGCTGGGTGTGG - Intergenic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
973884625 4:55307696-55307718 AGACAGTTATAGGCCGGGCGCGG - Intergenic
974029129 4:56760114-56760136 AAACAATTCTAGGCCAGGTGTGG - Intergenic
974051293 4:56944589-56944611 ACACAAGGATAGACCGGGTGCGG - Intergenic
974079997 4:57202360-57202382 AAACACTTGTAGACCAGGTGTGG + Intergenic
974164118 4:58178428-58178450 ACACACTTTTAGGCTGGGCGTGG - Intergenic
974735910 4:65931923-65931945 TTACAATGGTAGGCCGGGCGCGG + Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
975496278 4:75039239-75039261 ACACAGTTTCCGGCCGGGTGTGG + Intronic
975570043 4:75806273-75806295 ATCCATTTGTAGGCTGGGTGCGG - Intronic
975580567 4:75903318-75903340 TAACAAATTTAGGCCGGGTGTGG - Intergenic
976316986 4:83669029-83669051 ATACAAATGAAGGCCGGGTGTGG + Intergenic
976317576 4:83675156-83675178 ACAATATTGTAGGCTGGGCGTGG - Intergenic
976451706 4:85198430-85198452 ATGCAATTGGCGGCCGGGTGCGG - Intergenic
976650971 4:87434332-87434354 AAACAAGTGTAGGCCAGGTGTGG - Intronic
977174460 4:93803431-93803453 ACACCTTTTTTGGCCGGGTGCGG + Intergenic
977285351 4:95099004-95099026 AAATAATTGATGGCCGGGTGCGG - Intronic
977602001 4:98943548-98943570 AAAAAAAAGTAGGCCGGGTGTGG - Intergenic
977938661 4:102834456-102834478 ACAAGATTGAGGGCCGGGTGTGG + Intronic
978374930 4:108065194-108065216 AAATAATTTTAGGCTGGGTGTGG + Intronic
978595043 4:110368205-110368227 ATAAAAGTGAAGGCCGGGTGTGG - Intronic
978726292 4:111973413-111973435 AAACAATTCTAGGCCAGGCGCGG - Intergenic
978750879 4:112246213-112246235 ATATAATTTTAGGCTGGGTGTGG + Intronic
978786607 4:112616544-112616566 ACACAATTATGGGCCAGGAGTGG + Intronic
979959423 4:126999355-126999377 AGAAATTTTTAGGCCGGGTGTGG - Intergenic
980128811 4:128799498-128799520 ACATAATATTTGGCCGGGTGTGG + Intergenic
980145290 4:128975327-128975349 AAAAAGTTGTTGGCCGGGTGTGG - Intronic
980588703 4:134855070-134855092 AAACAATTGTTAGCAGGGTGAGG + Intergenic
980718720 4:136663949-136663971 AAACATTTCTAGGCTGGGTGTGG + Intergenic
980787903 4:137578426-137578448 ACAGAATTTTAGGCTGGGTGCGG - Intergenic
980830949 4:138128730-138128752 CAACAAGTGTCGGCCGGGTGCGG - Intergenic
980949947 4:139365326-139365348 AGACAAATGTAGGCCGCATGTGG - Intronic
981072237 4:140555758-140555780 AAAGCATTTTAGGCCGGGTGTGG - Intergenic
981196122 4:141922812-141922834 CAAAAATTGTAGGCCAGGTGCGG + Intergenic
981477645 4:145203788-145203810 AAATAATTTTAGGCCGGGCGTGG + Intergenic
982013582 4:151130149-151130171 AAACAATGGAAGGCCGGATGTGG + Intronic
982030908 4:151299909-151299931 AAACCAATGTCGGCCGGGTGTGG + Intronic
982882265 4:160734458-160734480 AGAAAATGTTAGGCCGGGTGCGG - Intergenic
983026779 4:162747384-162747406 ACTCAATAGTCGGCCGGGCGTGG - Intergenic
983226725 4:165092410-165092432 ACAGCACTGTGGGCCGGGTGCGG - Intronic
983232548 4:165143724-165143746 ACAGTATTGGTGGCCGGGTGTGG - Intronic
983605949 4:169584319-169584341 ACACATTTATAGGCCAGGCGTGG + Intronic
983635592 4:169895020-169895042 ACAAAAATATAGGCCAGGTGTGG + Intergenic
984113196 4:175645428-175645450 AGAAAATTGTAGGCCGGGTGGGG + Intronic
984117498 4:175700151-175700173 ATAGAGTTGTGGGCCGGGTGTGG - Intronic
984372950 4:178890088-178890110 ATAAAATTGAAGGCCGGGCGCGG + Intergenic
984433291 4:179676147-179676169 ACATAAATTTAGGCTGGGTGTGG - Intergenic
984566742 4:181340037-181340059 AGAAGGTTGTAGGCCGGGTGTGG - Intergenic
984577450 4:181467423-181467445 ATATACTAGTAGGCCGGGTGCGG - Intergenic
984629903 4:182050281-182050303 ACATATTTTTAGGCCAGGTGTGG - Intergenic
984746920 4:183230115-183230137 AAACAATAGGAGGCTGGGTGTGG - Intronic
984829950 4:183963714-183963736 CAACATTTTTAGGCCGGGTGTGG - Intronic
984974291 4:185216809-185216831 ACACTTTTGTCGGCCGGGCGAGG - Intronic
985032719 4:185806746-185806768 ACAGGATTCTAGGCCGGGCGCGG - Intronic
985360355 4:189169767-189169789 ACATAAAAGTAGGCTGGGTGCGG - Intergenic
985500357 5:240057-240079 AATTAAATGTAGGCCGGGTGCGG - Intronic
985737038 5:1589644-1589666 AATTAAATGTAGGCCGGGTGCGG + Intergenic
986603333 5:9496198-9496220 ACACAAAAGTTAGCCGGGTGCGG - Intronic
987074887 5:14371930-14371952 AGACATTTATAGGCCAGGTGTGG - Intronic
987373064 5:17210670-17210692 ACACAAATATTAGCCGGGTGTGG + Intronic
987771514 5:22311412-22311434 AAACAATTGTGGGCCGGGCGCGG + Intronic
987916643 5:24223583-24223605 AGATAATTTGAGGCCGGGTGTGG - Intergenic
988554950 5:32228284-32228306 AGAAAATTTGAGGCCGGGTGTGG - Exonic
988556428 5:32240108-32240130 AATGAATTGTAGGCCGGGCGCGG + Intronic
989174440 5:38508872-38508894 AAAGAAATTTAGGCCGGGTGTGG - Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
989517787 5:42363496-42363518 AAACAAATGTTGGCCGGGTGCGG - Intergenic
989589584 5:43101028-43101050 AAATAATTGAGGGCCGGGTGTGG + Intronic
990147431 5:52778465-52778487 AGAAAATTGTGGGCCGGGTGTGG + Intergenic
990805032 5:59650963-59650985 AAATAATTGTTGGCCGGGCGCGG + Intronic
991022763 5:61997803-61997825 AAACAATTTTCGGCCGGGCGCGG + Intergenic
991059690 5:62360392-62360414 ATATAATTCAAGGCCGGGTGCGG + Intronic
991261489 5:64673445-64673467 AAACAATTATTGGCCGGGCGCGG + Intergenic
991337511 5:65565511-65565533 AGCCAATAGTTGGCCGGGTGTGG + Intronic
991372826 5:65937616-65937638 AAATAATTCTTGGCCGGGTGCGG + Intronic
991774518 5:70071792-70071814 AAATAATTTTAGGCCGGGCGCGG - Intronic
991853812 5:70947217-70947239 AAATAATTTTAGGCCGGGCGCGG - Intronic
991900872 5:71459219-71459241 AGACAAGTATAGGCCGGGCGTGG + Intronic
991928572 5:71729366-71729388 AAAAAATTATAGGCCAGGTGTGG + Intergenic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992305029 5:75428386-75428408 AAAAAATAGTTGGCCGGGTGCGG + Intronic
992392760 5:76344416-76344438 AAATGATTTTAGGCCGGGTGCGG + Intronic
992437939 5:76773234-76773256 ACACAAACGAGGGCCGGGTGTGG + Intergenic
992456929 5:76924617-76924639 ATACATTTATGGGCCGGGTGTGG + Intergenic
992599188 5:78380773-78380795 AAACATTTGAAGGCCGGGAGCGG + Intronic
992643327 5:78788920-78788942 ACAAAAATGTAGGCCAGGTGTGG - Intronic
992652513 5:78873783-78873805 TTACAGTTTTAGGCCGGGTGCGG - Intronic
992687744 5:79214793-79214815 ACACAACTGGGGGCCGGGTGCGG + Intronic
992718978 5:79540702-79540724 AAAAAATTGTAGGCTAGGTGTGG + Intergenic
993201247 5:84818137-84818159 AACTAATTATAGGCCGGGTGCGG - Intergenic
993498562 5:88637532-88637554 ACAAACTTGAAGGCTGGGTGTGG + Intergenic
993640837 5:90403579-90403601 TCACAATTTTTGGCCGGGCGCGG + Intronic
993731705 5:91430347-91430369 ATAACATTGCAGGCCGGGTGTGG + Intergenic
994199360 5:96955070-96955092 ACATAATTGCAGGCCGGGCGCGG - Intronic
995008993 5:107236955-107236977 ACACAATTATAGGCTGGGTGCGG + Intergenic
995804205 5:116033087-116033109 ACATAGCTATAGGCCGGGTGTGG - Intronic
995813342 5:116134909-116134931 AAAAAATTGTAGGCCGGGCGCGG - Intronic
995884107 5:116873978-116874000 AAACAGTTGTCGGCCGGGCGCGG - Intergenic
996077813 5:119218084-119218106 ACAAAATTATTGGCCAGGTGTGG + Intronic
996541827 5:124638238-124638260 AAAAAACTGTTGGCCGGGTGTGG - Intronic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997310935 5:132881955-132881977 ACATAATTTGTGGCCGGGTGTGG - Intronic
997319367 5:132964504-132964526 AAACATTAGTGGGCCGGGTGCGG - Intergenic
997333408 5:133084758-133084780 AAAGAATAGTAGGCTGGGTGCGG - Intronic
997603476 5:135156374-135156396 ACACAATTGCAGGCATGATGAGG - Intronic
997931094 5:138071922-138071944 ACATATTTTTTGGCCGGGTGTGG + Intergenic
997987384 5:138513492-138513514 ACAGTATGGTGGGCCGGGTGCGG - Intronic
997998771 5:138607626-138607648 ATACAAAAATAGGCCGGGTGTGG - Intergenic
998036060 5:138917061-138917083 AAATAATTTTAGGCCAGGTGTGG - Intronic
998117972 5:139552970-139552992 ACAAAATTAGAGGCCGGGTGCGG - Intronic
998316867 5:141190463-141190485 AAATTATTGTAGGCTGGGTGCGG - Exonic
998328299 5:141301874-141301896 ACACAAAAGTTAGCCGGGTGTGG + Intergenic
998455163 5:142266440-142266462 ACACAATTGTGAACCTGGTGGGG - Intergenic
998630534 5:143893059-143893081 ACACATCTGTAGGCAGAGTGTGG - Intergenic
998680368 5:144460120-144460142 ATAAGATTGGAGGCCGGGTGCGG - Intronic
998981581 5:147709558-147709580 ATATCATTCTAGGCCGGGTGGGG + Intronic
999214332 5:149919214-149919236 GGACATTTCTAGGCCGGGTGCGG + Intronic
999734782 5:154505003-154505025 TCTTAATTGTAGGCCGGGTGCGG - Intergenic
1000143074 5:158425649-158425671 CCACAATTTGAGGCCAGGTGCGG + Intergenic
1000350492 5:160349081-160349103 CCACAACTGTAGGCTGGGGGTGG - Exonic
1000892299 5:166814513-166814535 ATCCCATTGAAGGCCGGGTGTGG - Intergenic
1001732760 5:173972612-173972634 AACAAATTGTGGGCCGGGTGCGG - Intergenic
1001846046 5:174922477-174922499 ACACAAGTTGAGGCCGGGCGTGG + Intergenic
1001993839 5:176138127-176138149 ACTTAGTTGTTGGCCGGGTGCGG - Intergenic
1002040787 5:176512627-176512649 ACCCAAATGTTGGCCGGGCGCGG - Intergenic
1002042204 5:176522660-176522682 ACAAAAATGAAGGCCGGGCGTGG - Intergenic
1002112851 5:176931694-176931716 AGACAACTGAAGGCCGGGTGCGG + Intronic
1002122923 5:177019639-177019661 AAAAAATTGTAGGCTGGGTGTGG + Intronic
1002125850 5:177043473-177043495 ACGCAATGGGAGGCTGGGTGCGG + Intronic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1003090601 6:3099252-3099274 AAACAAAAATAGGCCGGGTGCGG + Intronic
1003342039 6:5230984-5231006 ACACATTTCAAGGCCAGGTGCGG + Intronic
1003540948 6:7017622-7017644 ACACAAATCTAGGCTGGGCGTGG - Intergenic
1003590139 6:7430473-7430495 ACGAAACTGTAGGCCGGGCGCGG - Intergenic
1004122928 6:12842833-12842855 AAACACCTTTAGGCCGGGTGTGG - Intronic
1004198586 6:13527405-13527427 ATGCAACTGTGGGCCGGGTGTGG + Intergenic
1004386521 6:15177808-15177830 ATAAACTTGTTGGCCGGGTGCGG + Intergenic
1004653543 6:17635397-17635419 AAATAATGATAGGCCGGGTGCGG - Intronic
1004714134 6:18200461-18200483 ACAGAATTGGAGGCCGAGTCTGG + Exonic
1004718074 6:18238157-18238179 ACAAGATTCTAGGCCAGGTGTGG - Intronic
1005566981 6:27106051-27106073 AACTAATTGTAGGCTGGGTGTGG + Intergenic
1005683979 6:28234235-28234257 AATCAATTGTACGCCAGGTGTGG + Intergenic
1005742150 6:28802183-28802205 ACAAAATGGAAGGCCGGGCGCGG + Intergenic
1005976365 6:30803139-30803161 ATACAGCTCTAGGCCGGGTGTGG + Intergenic
1006148787 6:31975489-31975511 ATACAAAATTAGGCCGGGTGCGG - Intronic
1006371273 6:33645176-33645198 ATACAAATATTGGCCGGGTGTGG + Intronic
1006464689 6:34185798-34185820 ACAAAAATTGAGGCCGGGTGTGG + Intergenic
1006505967 6:34488848-34488870 AAAAAATAATAGGCCGGGTGAGG - Intronic
1007036927 6:38683595-38683617 AGACAAATGGAGGCCGGGCGTGG + Intronic
1007042088 6:38732004-38732026 AAAGAAATGTAGGCTGGGTGTGG - Intronic
1007472652 6:42100784-42100806 AAAAAATTGGGGGCCGGGTGCGG + Intergenic
1007549717 6:42719857-42719879 AGACAATTTAGGGCCGGGTGCGG - Intronic
1007671331 6:43556836-43556858 AAAGAAATGAAGGCCGGGTGTGG + Intronic
1008068132 6:47072348-47072370 AGAGAGTTGTTGGCCGGGTGTGG - Intergenic
1008149295 6:47931073-47931095 ACACAATGCTCGGCCGGGTGCGG - Intronic
1008606899 6:53149377-53149399 ATACAATTCTTGGCCGGGCGTGG + Intergenic
1008668847 6:53745932-53745954 AAAAAATTGAAGGCCAGGTGCGG + Intergenic
1008689409 6:53960746-53960768 AAACAATTCTTGGCCGGGCGCGG + Intronic
1008903312 6:56647974-56647996 AAGCCATTATAGGCCGGGTGCGG - Intronic
1008921567 6:56848742-56848764 ATACAATCATAGGCCAGGTGTGG + Intronic
1009240743 6:61183404-61183426 ATACATTTTGAGGCCGGGTGCGG + Intergenic
1009956788 6:70464972-70464994 ACAAAATTTTAGGTCAGGTGTGG - Intronic
1010218348 6:73425681-73425703 ACATAAATATAGGCCGGGCGTGG + Intronic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1010497714 6:76555510-76555532 AGAAAATTCTTGGCCGGGTGCGG + Intergenic
1011524847 6:88253364-88253386 ACACAACAGTAGGCCAGGCGTGG - Intergenic
1011585420 6:88919607-88919629 ATAAAATTGTGGGCCAGGTGTGG - Intronic
1011612158 6:89163055-89163077 AGACACTGGCAGGCCGGGTGCGG - Exonic
1013062421 6:106648005-106648027 AAAGTATTGTAGGCCGGGCGTGG + Intronic
1013125768 6:107182613-107182635 AATAAATTATAGGCCGGGTGTGG - Intronic
1013205801 6:107944907-107944929 ACAAAAATCTAGGCCGGGCGCGG + Intronic
1013498099 6:110719191-110719213 AAATAATTCTAGGCCAGGTGCGG + Intronic
1013540206 6:111100671-111100693 AGACAACTGTAGGCCGGGCACGG - Intronic
1013969963 6:116005083-116005105 ACACAATTGTAAGGCAGTTGGGG + Intronic
1014127202 6:117790054-117790076 ACCTAATTGTTGGCCGGGCGCGG - Intergenic
1014262821 6:119239166-119239188 ACCCAGTTTCAGGCCGGGTGCGG - Intronic
1014383071 6:120768351-120768373 AAACAATTTTTAGCCGGGTGTGG - Intergenic
1014437967 6:121441240-121441262 ACAAAAAAGTAGACCGGGTGCGG - Intronic
1014526623 6:122509037-122509059 AAAAAATTTTAGGCCGGGCGCGG - Intronic
1015144777 6:129973200-129973222 ACAAAAATTTCGGCCGGGTGCGG - Intergenic
1015586988 6:134786436-134786458 AAACATTTTTAGGCCAGGTGTGG - Intergenic
1015873196 6:137797628-137797650 ACAACAATGCAGGCCGGGTGCGG - Intergenic
1015911824 6:138176336-138176358 ACACAAAAATTGGCCGGGTGTGG - Intronic
1015923617 6:138289241-138289263 AAAAAATTGTAGCCTGGGTGTGG - Intronic
1015958850 6:138626601-138626623 AAAAAATTGTAGGCCGGGCGCGG + Intronic
1016029948 6:139326796-139326818 ACACATTTGTTGGACGGGCGTGG + Intergenic
1016064375 6:139663888-139663910 ACTGAATTGTTGGTCGGGTGCGG - Intergenic
1016097405 6:140055480-140055502 ACATAACTGTAGGCTGGGGGCGG - Intergenic
1016459934 6:144271674-144271696 ACTTAAATGTAAGCCGGGTGCGG + Intergenic
1016624184 6:146146375-146146397 ATACAATAGTAGGCCGGGCACGG - Intronic
1016682656 6:146848855-146848877 ACGTAATTGTGGGCCAGGTGCGG - Intergenic
1016744369 6:147562530-147562552 ACCAAAGTGTTGGCCGGGTGTGG + Intronic
1016966161 6:149720253-149720275 AAACATTTATTGGCCGGGTGTGG + Intergenic
1017156519 6:151327103-151327125 AAAAAAATGTAGGCCAGGTGCGG - Intronic
1017437911 6:154435283-154435305 AGAGATTTGTGGGCCGGGTGTGG - Intronic
1017504925 6:155059604-155059626 ACACAAATAGAGGCTGGGTGTGG - Intronic
1017926911 6:158918445-158918467 AAAGAACTGTTGGCCGGGTGCGG - Intergenic
1018194616 6:161344299-161344321 AAAAAAATATAGGCCGGGTGCGG + Intergenic
1018322946 6:162633142-162633164 AAAAAAATGTAGGCCGGGTGCGG + Intronic
1018571180 6:165211703-165211725 ATACACTTTTTGGCCGGGTGTGG + Intergenic
1018579599 6:165297128-165297150 ACCAAATTGGAGGCCAGGTGTGG + Intronic
1018631087 6:165823120-165823142 AAAAAATTATAGGCCGGGAGCGG - Intronic
1019136476 6:169911754-169911776 ACACATTTGTAGGCCTGGGCGGG + Intergenic
1019300907 7:303032-303054 AGGCAATGGTGGGCCGGGTGTGG - Intergenic
1019479301 7:1259218-1259240 ACACATTTTTAGGCCGGGCGCGG - Intergenic
1019496703 7:1343971-1343993 AAAGAGGTGTAGGCCGGGTGCGG + Intergenic
1019988684 7:4677207-4677229 AAATAATTGTAGGCTGGGCGTGG - Intergenic
1020064280 7:5175544-5175566 AGATCATAGTAGGCCGGGTGTGG + Intergenic
1020176609 7:5887255-5887277 ACACAAACGTTAGCCGGGTGTGG - Intergenic
1020253863 7:6490678-6490700 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1020691600 7:11361588-11361610 ACTCAATAGAAGGCCGGGCGCGG - Intergenic
1021411702 7:20336293-20336315 ACACAAGACTGGGCCGGGTGTGG - Intronic
1021465144 7:20934194-20934216 ACACATTTTTAGGCTGAGTGTGG - Intergenic
1021841723 7:24726531-24726553 TAACAATGGTAGGCCGGGCGCGG + Intronic
1022162849 7:27728853-27728875 ACATACTTCTGGGCCGGGTGCGG - Intergenic
1023105029 7:36755660-36755682 AATTAATTGTGGGCCGGGTGTGG - Intergenic
1023181710 7:37491485-37491507 ACATAATTTTAGGCCGGGCATGG - Intergenic
1023438789 7:40165823-40165845 TAACAATTGCAGGCCAGGTGTGG + Intronic
1023807979 7:43888209-43888231 AAACTATTTTAGGCCTGGTGTGG + Intronic
1024200501 7:47101632-47101654 ACACAGATGCAGGCCAGGTGAGG + Intergenic
1024637545 7:51302604-51302626 TCACAATTCTGGGCTGGGTGTGG + Intronic
1024708332 7:51986092-51986114 AAGCTATTTTAGGCCGGGTGTGG - Intergenic
1024813666 7:53242997-53243019 ACAAAAGTGGAGGCCGGGCGCGG - Intergenic
1025066022 7:55856780-55856802 AAACAAGTGCAGGCCAGGTGTGG + Intronic
1025193790 7:56916952-56916974 ACAGGAGTGTAGGCCGGGCGTGG + Intergenic
1025610036 7:63070030-63070052 ACAAAAAAATAGGCCGGGTGCGG - Intergenic
1025696210 7:63776339-63776361 AGAAAATGGTAGGCCAGGTGTGG - Intergenic
1025778766 7:64581073-64581095 ATATAACTGTCGGCCGGGTGCGG + Intergenic
1025938969 7:66059901-66059923 ATGCTATTGTAGGCCGGGCGTGG - Intergenic
1025977825 7:66383239-66383261 ACAGAATAATAGGCCGGGCGCGG - Intronic
1026134785 7:67650395-67650417 AAAAAATTGCAGGCTGGGTGCGG + Intergenic
1026250854 7:68669280-68669302 ACAACATTCTCGGCCGGGTGCGG - Intergenic
1026362095 7:69611638-69611660 TAAAAATTGTAGGCCGGGCGCGG + Intronic
1026517589 7:71086344-71086366 AGACAAGGGAAGGCCGGGTGTGG + Intergenic
1026572935 7:71547575-71547597 ACAGAATTTAAGGCTGGGTGCGG - Intronic
1026741027 7:72978635-72978657 AAACAATAACAGGCCGGGTGCGG - Intergenic
1026819035 7:73534411-73534433 ACAAAAATGTAGGCCGGGCGTGG - Intergenic
1026838704 7:73655865-73655887 AGAAAATTTGAGGCCGGGTGTGG + Intergenic
1026908190 7:74076029-74076051 AAACAATTCCAGGCCGGGCGCGG + Intergenic
1026985064 7:74549743-74549765 ACAAAAATTAAGGCCGGGTGCGG + Intronic
1027048224 7:75005155-75005177 ACATAAATTTAGGCCGGGTGCGG - Intronic
1027102706 7:75386439-75386461 AAACAATAACAGGCCGGGTGCGG + Intergenic
1027113909 7:75463166-75463188 ATACAAAAGTAAGCCGGGTGTGG + Intronic
1027286161 7:76647771-76647793 ATACAAAAGTAAGCCGGGTGTGG + Intergenic
1027339927 7:77195945-77195967 AAATAATTGTTGGCTGGGTGTGG - Exonic
1027353798 7:77337463-77337485 AAACTGTTGTAGGCTGGGTGCGG - Intronic
1027416135 7:77976820-77976842 AGACTATTTTAGGCCGGGCGTGG + Intergenic
1027768163 7:82372892-82372914 ACACAATATCAGGCCAGGTGTGG + Intronic
1027845859 7:83373914-83373936 ACTCAAATTTAGGCCGGGCGCGG + Intronic
1027941027 7:84679524-84679546 AAACTATTCTAGGCCGGGCGCGG + Intergenic
1028244676 7:88462655-88462677 ACTAAATTGTAGGCTGGGCGCGG - Intergenic
1028545281 7:91992371-91992393 ACTCAATTGTAGGCCAGGCGTGG + Intronic
1029082223 7:97983765-97983787 ACACAAACGTTAGCCGGGTGTGG + Intergenic
1029288680 7:99484771-99484793 ATACAAATTTAAGCCGGGTGTGG + Intronic
1029417044 7:100449832-100449854 AAATAATTTTAGGCCGGGTGCGG - Intergenic
1029455711 7:100670721-100670743 AAACAATTGTAGGCTGGGCACGG + Intergenic
1029594706 7:101531259-101531281 ATAAAAAGGTAGGCCGGGTGTGG - Intronic
1029670534 7:102027568-102027590 ACATCGTTGTAGGCCAGGTGCGG + Intronic
1029684002 7:102132959-102132981 AAACAAATTAAGGCCGGGTGCGG - Intronic
1029992470 7:104974757-104974779 AATCAAATGTAGGCCGGGCGCGG + Intergenic
1030185179 7:106754738-106754760 AAATCATTGTAGGCCAGGTGCGG + Intergenic
1030216907 7:107053119-107053141 AAATAAATGTAGGCTGGGTGTGG - Intronic
1030422399 7:109324190-109324212 ACATAATTTTAGGCCGGGTGCGG - Intergenic
1031046431 7:116893417-116893439 AAACACTTTTAGGCCGGATGTGG - Intronic
1031340577 7:120595158-120595180 ATCCATATGTAGGCCGGGTGTGG + Intronic
1031400994 7:121326421-121326443 ACACAATTTTAGGGCGTGAGTGG - Intronic
1031524258 7:122805446-122805468 AAATAATTGAAGACCGGGTGTGG - Intronic
1031637787 7:124122410-124122432 AAATAAATGTGGGCCGGGTGCGG + Intergenic
1032071998 7:128813688-128813710 AAAGAATTCTAGGCCAGGTGCGG + Intronic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032157608 7:129481875-129481897 AAACAAAAGTAGGCTGGGTGTGG + Intronic
1032233102 7:130093514-130093536 ACAAAAATATAGGCCGGGTGTGG - Intronic
1032269509 7:130390939-130390961 AAACAATTTTAGGCTGGGTGTGG + Intergenic
1032367167 7:131310013-131310035 ACCCACTTGTGGGCCGGGCGTGG - Intronic
1032576527 7:133060616-133060638 ACCCAAAAGGAGGCCGGGTGCGG + Intronic
1032762670 7:134958684-134958706 ACACTATTGGGGGCCAGGTGTGG - Intronic
1032918632 7:136520647-136520669 ATACTACTGTTGGCCGGGTGCGG + Intergenic
1033068916 7:138183591-138183613 AGAAAATAGTAGGCCGGGCGCGG - Intergenic
1033132994 7:138761342-138761364 ACACAAATTCAGGCCAGGTGCGG + Intronic
1033152557 7:138928209-138928231 AGACAATAGTAGGCCGGGCGTGG - Intronic
1033173668 7:139106317-139106339 AAACAATTATAGGCCAGGTGAGG + Intronic
1033286021 7:140041056-140041078 ATACAAGTTTAGGCCGGGCGTGG - Intronic
1033714357 7:143984520-143984542 ACAAAAATGTAGGCCAGATGCGG + Intergenic
1033935931 7:146585408-146585430 ACTCAGGTTTAGGCCGGGTGCGG - Intronic
1034159871 7:148985624-148985646 TTACAATTCAAGGCCGGGTGTGG + Intergenic
1034250307 7:149685262-149685284 TCACACACGTAGGCCGGGTGTGG + Intergenic
1034327328 7:150248370-150248392 AAAAAAGAGTAGGCCGGGTGCGG + Intronic
1034333712 7:150306554-150306576 AAACAACTGTGGGCCGGGTATGG + Intronic
1034664334 7:152803336-152803358 AAACAACTGTGGGCCGGGTATGG - Intronic
1034681964 7:152935715-152935737 GCACAGTTTTAGGCTGGGTGGGG - Intergenic
1034703897 7:153123048-153123070 AAACAAGTGTAAGCTGGGTGCGG + Intergenic
1034733246 7:153406117-153406139 GTACAATTCTAGGCCAGGTGCGG - Intergenic
1034765881 7:153721079-153721101 AAAAAAGAGTAGGCCGGGTGCGG - Intergenic
1034916794 7:155046810-155046832 AAATAATTATAGGCTGGGTGTGG + Intergenic
1035236436 7:157500564-157500586 ACATAATAATAGGCCGGGCGCGG - Intergenic
1035740060 8:1920616-1920638 ACACAAGTATAGGCTGGTTGTGG - Intronic
1035880103 8:3237175-3237197 ACAACTTTGCAGGCCGGGTGCGG + Intronic
1036118293 8:5985830-5985852 ACACAACTGAGGGCCGGGCGCGG + Intergenic
1036167287 8:6447837-6447859 ACAAAATTGTTGGCCGGGCGCGG - Intronic
1036407108 8:8464921-8464943 AAACAAATATAGGCCGGGTGCGG - Intergenic
1036538253 8:9673731-9673753 AAAAAATTCCAGGCCGGGTGCGG - Intronic
1036647420 8:10620313-10620335 ACACAACAGTGGGCTGGGTGCGG + Intronic
1037088160 8:14879032-14879054 ACCTAATTGTAGGCCAGGTGTGG + Intronic
1037314678 8:17589939-17589961 TAACAATTGCAGGCCGGGTGCGG + Intronic
1037479640 8:19292417-19292439 AAACTATTCAAGGCCGGGTGCGG - Intergenic
1037562837 8:20089948-20089970 AGGCAATTTTAGGCCGGGCGCGG - Intergenic
1037801036 8:22036091-22036113 AGACATTTGTGGGCCAGGTGTGG + Intronic
1037846573 8:22288006-22288028 TTGCAAATGTAGGCCGGGTGCGG + Intronic
1037982725 8:23266279-23266301 AAGCAACTCTAGGCCGGGTGTGG + Intergenic
1038072672 8:24035119-24035141 ACACAATAATGGGCTGGGTGCGG + Intergenic
1038156025 8:24991291-24991313 AAACATTTTGAGGCCGGGTGCGG - Intergenic
1038533540 8:28337879-28337901 ATGGAAGTGTAGGCCGGGTGCGG - Intronic
1038616114 8:29096572-29096594 AGCCACCTGTAGGCCGGGTGCGG - Intronic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1038686507 8:29723660-29723682 CTACCAATGTAGGCCGGGTGCGG - Intergenic
1038940277 8:32296824-32296846 ACATATTTATAGGCCGGGTGTGG + Intronic
1039052638 8:33508849-33508871 ACTCAACTGTAGGCCGGGCGGGG + Intronic
1039505084 8:38046191-38046213 AGCCAGGTGTAGGCCGGGTGGGG - Intronic
1039872428 8:41557786-41557808 TCACAATGGTGGGCCGGGCGCGG - Intergenic
1040020307 8:42735245-42735267 ACACTAATACAGGCCGGGTGTGG + Intronic
1040028706 8:42804774-42804796 AAATTATTGCAGGCCGGGTGCGG - Intergenic
1040047860 8:42981341-42981363 ACACTATTTTTGGCTGGGTGTGG - Intronic
1040421731 8:47246517-47246539 ATAAAATTGGAGGCTGGGTGTGG - Intergenic
1040430556 8:47337419-47337441 ACACAAATAAAGGCCAGGTGTGG - Intronic
1040779260 8:51088469-51088491 ACATCAGTGTCGGCCGGGTGCGG + Intergenic
1040846136 8:51842612-51842634 ATACAAATATAGGCTGGGTGTGG - Intronic
1040889467 8:52301932-52301954 ACACGAGTGCAGGCCAGGTGAGG + Intronic
1041541382 8:58989022-58989044 ACAAAACTTTAGGCTGGGTGCGG + Intronic
1041633169 8:60111043-60111065 GCATAATTATAGGCCGGGCGTGG - Intergenic
1041766140 8:61420307-61420329 AAAACATTGTTGGCCGGGTGCGG + Intronic
1042260885 8:66858173-66858195 ACAAAATGCTAGGACGGGTGCGG + Intronic
1042312474 8:67392677-67392699 AGGCAATTATAGGCTGGGTGTGG - Intergenic
1042403303 8:68374203-68374225 AAAGAATTATAGGCCAGGTGTGG - Intronic
1042745896 8:72105173-72105195 TAAAAATTGTAGGCCAGGTGTGG - Intronic
1043075935 8:75699437-75699459 ATACAATTTAAGGCTGGGTGTGG + Intergenic
1043093637 8:75937035-75937057 ACAATATTTTGGGCCGGGTGTGG + Intergenic
1043215794 8:77585898-77585920 ACACTAATGTTGGCCGGGCGCGG + Intergenic
1043278157 8:78427765-78427787 AAAAAATTATAGGCCGGGCGCGG + Intergenic
1043457747 8:80429238-80429260 TTACAATTTTGGGCCGGGTGTGG + Intergenic
1043688562 8:83120524-83120546 AGACACTTTGAGGCCGGGTGCGG + Intergenic
1044666150 8:94636510-94636532 AAAAAAAGGTAGGCCGGGTGTGG - Intergenic
1044720295 8:95139211-95139233 TTACAAATGTTGGCCGGGTGCGG + Intronic
1045004067 8:97902203-97902225 ACACAGTGTTAGGCCGGGTGTGG + Intronic
1045142105 8:99298196-99298218 ATACTTTTGTCGGCCGGGTGCGG + Intronic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1045304030 8:100941492-100941514 AAACATTTCTAGGCCGGGTATGG + Intronic
1045465370 8:102464614-102464636 AAAATATTTTAGGCCGGGTGCGG - Intergenic
1045630311 8:104111694-104111716 AGCCAATGGGAGGCCGGGTGCGG - Intronic
1045841606 8:106588247-106588269 AAAAAATTGTTGGCCGGATGCGG - Intronic
1046510121 8:115191628-115191650 AAACAATGGAAGGCCTGGTGTGG + Intergenic
1046769057 8:118100457-118100479 AGTCAATTGGAGGCGGGGTGCGG + Intronic
1047601760 8:126432675-126432697 AAACAATAGTAGGCTGGGTGCGG + Intergenic
1047857550 8:128928034-128928056 AAACACTTTTAGGCTGGGTGCGG - Intergenic
1048601586 8:135924013-135924035 ACACAAAAGTTAGCCGGGTGTGG + Intergenic
1048942038 8:139408279-139408301 TCATAAGTATAGGCCGGGTGCGG + Intergenic
1048988903 8:139750019-139750041 ACACAATCCAAGACCGGGTGAGG + Intronic
1049083712 8:140461728-140461750 ATACAAAATTAGGCCGGGTGCGG - Intergenic
1049890346 9:63471-63493 ACACAAATGTGTGCCGGGAGGGG + Intergenic
1050443379 9:5689339-5689361 AACAAATTGTAGGCCGGGCGCGG - Intronic
1050533142 9:6608121-6608143 AAACAATTGAGGGCCGGGCGGGG + Intronic
1050853651 9:10322360-10322382 ACACAATTGCAGGCTGAGTCAGG + Intronic
1050864574 9:10482079-10482101 AAACAAATGTTGGCCGGGCGCGG + Intronic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051594737 9:18813252-18813274 ACAAAGTTGGGGGCCGGGTGTGG - Intronic
1052307663 9:27029455-27029477 ACAATATAGTCGGCCGGGTGTGG + Intronic
1052338959 9:27346702-27346724 ATACCATTAGAGGCCGGGTGCGG + Intronic
1052385492 9:27818982-27819004 ACAAACTTGAAGGCAGGGTGTGG + Intergenic
1052453498 9:28663459-28663481 ATACAACTGCAGGCCGGATGCGG - Intronic
1052741263 9:32395183-32395205 ACATAAATGCAGGCTGGGTGTGG + Intronic
1052848450 9:33358987-33359009 ATACCAATTTAGGCCGGGTGTGG - Intronic
1052934008 9:34078187-34078209 AAAAAATTGGGGGCCGGGTGTGG - Intergenic
1052948619 9:34189477-34189499 ACATAATGATCGGCCGGGTGCGG - Intronic
1053084477 9:35206578-35206600 ACCATAGTGTAGGCCGGGTGTGG + Intronic
1053146553 9:35716063-35716085 AAATAATTTTAGGCCAGGTGTGG + Intronic
1053251158 9:36574844-36574866 CCCCAATTATAGGCCGGGCGCGG + Intronic
1053488999 9:38485916-38485938 AAAAAATTCAAGGCCGGGTGTGG - Intergenic
1053554396 9:39120382-39120404 AAACCTTTTTAGGCCGGGTGCGG + Intronic
1053579616 9:39391064-39391086 ACACAAATTTAGGCTGGGCGTGG + Intergenic
1053844130 9:42219144-42219166 ACACAAATTTAGGCCGGGCGTGG + Intergenic
1054101203 9:60949873-60949895 ACACAAATTTAGGCTGGGCGTGG + Intergenic
1054122576 9:61225236-61225258 ACACAAATTTAGGCTGGGCGTGG + Intergenic
1054585149 9:66957007-66957029 ACACAAATTTAGGCCGGGCGTGG - Intergenic
1055057968 9:72040968-72040990 ACAAACTTATTGGCCGGGTGTGG + Intergenic
1055306157 9:74930994-74931016 TTAAAATTGTGGGCCGGGTGTGG + Intergenic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1055441380 9:76339831-76339853 AAACATTTATTGGCCGGGTGCGG - Intronic
1055596121 9:77866185-77866207 ACAAAAATTTAGGCCGGGTGTGG + Intronic
1055765142 9:79654851-79654873 ACACCATTGTAGGCCGGGCTTGG + Intronic
1056162586 9:83911517-83911539 ACATAAAAGTGGGCCGGGTGTGG - Intronic
1056335145 9:85561079-85561101 AGACCATTTTCGGCCGGGTGTGG + Intronic
1056406251 9:86278372-86278394 ATATATTTGTAGGCCAGGTGTGG + Intronic
1056471016 9:86904527-86904549 ACCCAAAAGTAGGCCAGGTGTGG + Intergenic
1056743294 9:89278799-89278821 ACACCACTGCAGGCCGGGCGTGG + Intergenic
1057124389 9:92604882-92604904 ATAAAAATGCAGGCCGGGTGTGG - Intronic
1057210710 9:93199606-93199628 ACAAAGCTGTGGGCCGGGTGCGG + Intronic
1057368045 9:94442558-94442580 AAACAAAAATAGGCCGGGTGCGG + Intronic
1057456452 9:95217193-95217215 ACACATTTCTAGGCCGGGCCTGG + Intronic
1057586493 9:96333304-96333326 ATGGAATTGTAGGCCGGGCGTGG + Intronic
1057669352 9:97075204-97075226 AAAAAATTCAAGGCCGGGTGCGG - Intergenic
1057703425 9:97380474-97380496 ATACAACTCTAGGCTGGGTGTGG - Intergenic
1057715403 9:97491220-97491242 ACAGAAATGTGGGCTGGGTGTGG - Intronic
1057901014 9:98948306-98948328 ACACACTTGTCGGCCGGGCGCGG + Intronic
1058008073 9:99940769-99940791 GTAAAATTCTAGGCCGGGTGCGG - Intronic
1058127430 9:101211055-101211077 CCATAATTATAGGCCGGGGGCGG - Intronic
1058210898 9:102168565-102168587 ACATATTTGTAGGCCGGGCATGG - Intergenic
1058296688 9:103316847-103316869 AAACAATTTTAGTCTGGGTGTGG + Intergenic
1058326079 9:103699443-103699465 ACATAATTGTAGGCCGAATCTGG + Intergenic
1058715687 9:107720201-107720223 TCAGAATAGCAGGCCGGGTGCGG - Intergenic
1058861586 9:109122006-109122028 AGGCAAATGTAGGCCAGGTGCGG - Intergenic
1058882043 9:109294014-109294036 AAATCATTGTTGGCCGGGTGTGG + Intronic
1058897052 9:109409534-109409556 TCTCAATTCTAGGCTGGGTGCGG + Intronic
1058986099 9:110209363-110209385 ACATCATATTAGGCCGGGTGTGG - Intergenic
1058989103 9:110237984-110238006 ACACAAATATGGGCCAGGTGTGG + Intergenic
1059122230 9:111651594-111651616 ACAGAATTGCAGGCTAGGTGCGG + Intronic
1059128385 9:111717301-111717323 AAACAAGTCTAGGCTGGGTGTGG + Intronic
1059204304 9:112449571-112449593 TCATCATTTTAGGCCGGGTGCGG + Intronic
1059355027 9:113692120-113692142 ACAGAAATGCAGGCCGGGCGTGG - Intergenic
1059734294 9:117086282-117086304 ACTCAAGTCTTGGCCGGGTGCGG + Intronic
1059737372 9:117115733-117115755 AGACAATTGCTGGCCGGGCGCGG + Intronic
1059971666 9:119674909-119674931 ACAAAAAAGTTGGCCGGGTGTGG - Intergenic
1059981043 9:119772400-119772422 ACATAATTTTAGGCAGGGCGTGG + Intergenic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060511168 9:124233758-124233780 ATAAAATTTTAGGCCGGGCGTGG - Intergenic
1060577151 9:124706804-124706826 ACAAAATTGTTGGCCGGGCGAGG - Intronic
1060598987 9:124865497-124865519 ACCCAACTTAAGGCCGGGTGAGG + Intronic
1061027375 9:128058758-128058780 TAACAATTATTGGCCGGGTGCGG - Intergenic
1061076846 9:128346709-128346731 ACAAAATAAAAGGCCGGGTGTGG + Intronic
1061142704 9:128778092-128778114 ATACAAAATTAGGCCGGGTGTGG + Intergenic
1061143447 9:128782525-128782547 AAATTTTTGTAGGCCGGGTGTGG + Intergenic
1061271030 9:129542757-129542779 ACAGGATTGTTGGCTGGGTGTGG - Intergenic
1061428876 9:130518598-130518620 ATATATTTATAGGCCGGGTGAGG + Intergenic
1061437230 9:130571990-130572012 AAAAAAATCTAGGCCGGGTGTGG - Intergenic
1061647212 9:132013913-132013935 AAATAATTCTGGGCCGGGTGTGG + Intronic
1062060126 9:134490876-134490898 ACCCAAGAATAGGCCGGGTGCGG + Intergenic
1185531274 X:820930-820952 ACACAAAAATTGGCCGGGTGTGG - Intergenic
1185582108 X:1217641-1217663 ATACATTTGTTGGCCGGATGCGG + Intergenic
1185665016 X:1758774-1758796 AGACAATTACAGGCTGGGTGTGG + Intergenic
1185670844 X:1808609-1808631 AAACACATATAGGCCGGGTGAGG - Intergenic
1185687661 X:1942762-1942784 ATACTATTTTAGGCCGGGTGTGG + Intergenic
1185783719 X:2871396-2871418 AAAAAATTCTAGGCCAGGTGTGG + Intronic
1186825634 X:13337260-13337282 AGAAAATAGGAGGCCGGGTGTGG - Intergenic
1187058333 X:15762112-15762134 ACACAAAAGTTAGCCGGGTGTGG + Intronic
1187063161 X:15807578-15807600 ACACAATGCTAGGCCGGGCATGG - Intronic
1187148676 X:16661248-16661270 ATACAGCTATAGGCCGGGTGTGG - Intronic
1187338994 X:18404735-18404757 ACACAATTCAGGGCCAGGTGTGG + Intergenic
1187351861 X:18526035-18526057 TCAATATTGTTGGCCGGGTGCGG - Intronic
1187470731 X:19567226-19567248 ATAAAATTGCAGGCTGGGTGCGG + Intronic
1187679491 X:21752805-21752827 ACAGCATAGTAGGCCGGGCGCGG - Intronic
1188175724 X:26986297-26986319 TAATAATTGTAGGCCGGGCGCGG - Intergenic
1188315541 X:28668546-28668568 AAACAATTCTTGGCCGGGTGCGG - Intronic
1188472178 X:30553382-30553404 AATAAATAGTAGGCCGGGTGCGG + Intergenic
1189125932 X:38446242-38446264 AAACCATTGCAGGCTGGGTGCGG - Intronic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1189460932 X:41242469-41242491 AGTTAATTTTAGGCCGGGTGTGG + Intergenic
1190176106 X:48151293-48151315 ATTCAATGGTAGGCCGGGCGTGG + Intergenic
1190202694 X:48377440-48377462 ACTCAACCGTAGGCCGGGTGTGG + Intergenic
1190207844 X:48417970-48417992 ACTCAACCGTAGGCCGGGTGTGG - Intergenic
1190278827 X:48916556-48916578 ACAAAATTAGAGGCCGGGCGCGG + Intronic
1190292752 X:49003473-49003495 ACACAAAAATTGGCCGGGTGTGG + Intergenic
1190516702 X:51231319-51231341 TAACAATTGCAGGCCGGGTGTGG + Intergenic
1190551443 X:51586017-51586039 ACAATCTTTTAGGCCGGGTGCGG - Intergenic
1190565748 X:51729008-51729030 AGACACTTGTGGGCCAGGTGTGG - Intergenic
1190689296 X:52900184-52900206 ATACAAATGTGAGCCGGGTGTGG + Intronic
1190696687 X:52955608-52955630 ATACAAATGTGAGCCGGGTGTGG - Intronic
1190810897 X:53882348-53882370 AGAAAACTGCAGGCCGGGTGCGG - Intergenic
1190829574 X:54047897-54047919 TCAAAAGTGTTGGCCGGGTGTGG + Intronic
1191995471 X:67090726-67090748 ACAGAAATGTAGGCCAGGTCTGG + Intergenic
1192464551 X:71344947-71344969 AAATAATTGTTGGCCGGGTGCGG - Intergenic
1192781060 X:74293970-74293992 AAATAATTGTAGCCCGGGCGCGG + Intergenic
1192783215 X:74314768-74314790 ACACAATTGTCGGCCGGGCGCGG - Intergenic
1193138847 X:78004456-78004478 ATTCAAATGTAGGCTGGGTGTGG + Intronic
1193138956 X:78005389-78005411 ACAATATTGGAGGCTGGGTGCGG + Intronic
1193378272 X:80787792-80787814 AGACACTGGTAGGCCGGGCGTGG + Intronic
1193454714 X:81716388-81716410 ACATAACTGTTGGCCGGGCGCGG - Intergenic
1193609081 X:83606617-83606639 ATACAATATGAGGCCGGGTGTGG - Intergenic
1194002715 X:88451477-88451499 AGAAAATTTCAGGCCGGGTGGGG - Intergenic
1194861213 X:99000961-99000983 TCAAAATTGTAAGCCGGGCGTGG - Intergenic
1195053514 X:101121029-101121051 ACACAAAAGTTAGCCGGGTGTGG - Intronic
1195165983 X:102220983-102221005 ATATAATAGTAGGCCGGGCGCGG - Intronic
1195192876 X:102466105-102466127 ATATAATAGTAGGCCGGGCGCGG + Intronic
1195237222 X:102912313-102912335 AAAGAATTTTAGGCTGGGTGTGG + Intergenic
1195253532 X:103071227-103071249 AGAAAAATGTAGGCCGGGCGTGG - Intergenic
1195391913 X:104371027-104371049 TCTCCATTGCAGGCCGGGTGCGG - Intergenic
1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG + Intronic
1195778292 X:108432543-108432565 AAACAAGAGGAGGCCGGGTGCGG + Intronic
1196292176 X:113955685-113955707 AATGATTTGTAGGCCGGGTGTGG + Intergenic
1196405000 X:115352007-115352029 AAAAAGTTGTTGGCCGGGTGCGG + Intergenic
1196476951 X:116098267-116098289 AAACAATTATTGGCCAGGTGTGG - Intergenic
1196733759 X:118966577-118966599 AAACAATTGCTGGCCGGGCGCGG - Intergenic
1198068856 X:133128035-133128057 AAACAGGTGGAGGCCGGGTGTGG + Intergenic
1198143564 X:133831438-133831460 ACTCAACTGTAGGCTGGGTGTGG + Intronic
1198150386 X:133902952-133902974 ACACCATTTTAGGCCGGGTGCGG + Intronic
1198185263 X:134248451-134248473 ACAGAATTATAGGCCGGGCATGG - Intergenic
1198863721 X:141097782-141097804 ATACAAATTTTGGCCGGGTGCGG - Intergenic
1198898967 X:141489595-141489617 ATACAAATTTTGGCCGGGTGCGG + Intergenic
1199012810 X:142777429-142777451 TCACAATTCTGGGCAGGGTGTGG + Intergenic
1199288936 X:146084867-146084889 ACATAAATGTCGGCCGGGCGCGG + Intergenic
1199780500 X:151054231-151054253 AAAAAATTATAGGCCAGGTGTGG + Intergenic
1200140486 X:153899944-153899966 ACACAAAAATTGGCCGGGTGTGG + Intronic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic
1202588857 Y:26461005-26461027 AAGCAACTGTAGGCCAGGTGCGG - Intergenic