ID: 1158465957

View in Genome Browser
Species Human (GRCh38)
Location 18:57690104-57690126
Sequence GGTCAGAAACAGAATGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158465956_1158465957 -8 Left 1158465956 18:57690089-57690111 CCAGGAAGGAGAAGTGGTCAGAA 0: 1
1: 0
2: 4
3: 43
4: 382
Right 1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG 0: 1
1: 0
2: 1
3: 26
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158465957 Original CRISPR GGTCAGAAACAGAATGAGTC AGG Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900862854 1:5245472-5245494 GGACAGAAATAAAATGAGTGAGG + Intergenic
903228740 1:21909134-21909156 GGACAGAGCCAGAAGGAGTCAGG + Intronic
903984482 1:27215832-27215854 GGTGAGAAACAGAGTGGCTCTGG - Intergenic
905288811 1:36907541-36907563 GGTCCAAAACAGAGTGAGTCAGG + Intronic
906218659 1:44060066-44060088 GGCCACAAACAAAATGAGCCTGG - Intergenic
906423273 1:45688131-45688153 GGGCTGAAAAAAAATGAGTCCGG - Exonic
906615382 1:47229851-47229873 GGTCAGAGAGAGAATGAGGTGGG - Intronic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907380290 1:54081629-54081651 GGCAAGAAAGAGAAGGAGTCTGG - Intronic
908669007 1:66524949-66524971 GGTCACTAACTGAATCAGTCTGG - Intergenic
909994485 1:82262226-82262248 GCTAAGAAACTGAATGAGCCTGG - Intergenic
911841007 1:102681877-102681899 GGTCAGATACAGATTAAGTCAGG - Intergenic
911951665 1:104181228-104181250 GGTCAGAAACAGGATCAGATAGG - Intergenic
912024478 1:105150438-105150460 GTTTTGAAACAGAATGAGTTAGG + Intergenic
915579733 1:156806210-156806232 AGACAGAAACAGAAGGAGCCTGG + Intergenic
916003571 1:160638963-160638985 GGTGAGAAACTGGATGAGTGTGG - Intronic
916661479 1:166925914-166925936 GGCCAGAGACAGAGTGAGTCAGG - Intronic
919563718 1:199157557-199157579 GCTCAGAAACAGAAAGTGTCAGG - Intergenic
921935506 1:220792206-220792228 GGTCAGTGTCAGAATGAGGCTGG + Intronic
923409672 1:233694547-233694569 AGTCAGAAACAGAATTAATCCGG - Intergenic
924737826 1:246774619-246774641 GCTCAGAAACAGATTTATTCAGG - Intergenic
1062870485 10:898702-898724 GGAAAGAAAAAGAATGAGTTTGG + Intronic
1063862749 10:10329519-10329541 GGTCAGAAAAAGAATGAACCTGG - Intergenic
1064527248 10:16269908-16269930 GGCAAGAAACAGATTCAGTCAGG + Intergenic
1065366090 10:24938410-24938432 GGGTGGAAACAGCATGAGTCTGG + Intronic
1066456196 10:35574468-35574490 GCTCAGAAACAGACTAAGACAGG - Intergenic
1066571552 10:36778601-36778623 GGTCAGAAGCAGAATGGGAGAGG - Intergenic
1069462314 10:68607276-68607298 ACTCAGAAACAGTATGAATCCGG - Intronic
1069963341 10:72092289-72092311 GGTCAGAAGAAGACAGAGTCTGG + Intergenic
1070168773 10:73916786-73916808 GGTCAGTAACATGTTGAGTCAGG - Exonic
1070946592 10:80397045-80397067 AGTCAGACACAGAAACAGTCAGG + Intergenic
1076023431 10:127092817-127092839 GGTCAGAAACAGAATGAAAATGG + Intronic
1076459999 10:130635739-130635761 GGGCAGAACCAGATGGAGTCTGG - Intergenic
1076506873 10:130984195-130984217 TGTCAAAGACAAAATGAGTCTGG + Intergenic
1076647038 10:131960822-131960844 GGTCAGAGCCAGCAGGAGTCCGG + Intergenic
1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG + Intergenic
1078105364 11:8354947-8354969 GATCAGAAACAGAAGCATTCAGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1082105487 11:48216947-48216969 GGTCAGTATCAGCAAGAGTCTGG + Exonic
1082774457 11:57234887-57234909 AGTCAGAAACAGGAGGACTCGGG + Exonic
1083052914 11:59792946-59792968 GGGCAGAAATAAGATGAGTCAGG + Intronic
1084671837 11:70611561-70611583 GGACAGAAACAGAGGGTGTCTGG + Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1090497475 11:127228463-127228485 TGTCTCCAACAGAATGAGTCTGG + Intergenic
1090627426 11:128618990-128619012 ACTCAGGAACAAAATGAGTCGGG + Intergenic
1092400406 12:8171607-8171629 GGACAGAAACACCATGACTCAGG + Intronic
1092683314 12:11013821-11013843 GGTGGGAAACAGATTGAGGCTGG - Intronic
1093498471 12:19783564-19783586 GGCCAGAAACAAAACCAGTCTGG + Intergenic
1093754339 12:22835375-22835397 GGTCAGAAGCTGAATGTTTCTGG + Intergenic
1093833097 12:23790671-23790693 GGTCATAAGTAGAATGATTCTGG - Intronic
1097965163 12:65571320-65571342 TGTCAGGAACAGAATGGTTCTGG - Intergenic
1098200692 12:68052247-68052269 GATGATAAACAGAATGAGTATGG + Intergenic
1106231381 13:27823753-27823775 GGCCAGAAAGAGAAAGACTCAGG - Intergenic
1106865960 13:33964440-33964462 GGACAAAAACAGAATGATTTGGG - Intronic
1107201109 13:37718824-37718846 TAACAGAAAGAGAATGAGTCAGG + Intronic
1108323853 13:49310910-49310932 GCTCAGAAACTCAATGAGTTTGG + Exonic
1109699394 13:66005958-66005980 AGCCAGAAACACAATGAGCCAGG + Intergenic
1109988065 13:70016573-70016595 GGGCTGAAACAGAAGGAGGCTGG - Intronic
1112193273 13:97199129-97199151 GGCCAGAAACAGCAGGAGGCTGG - Intergenic
1112489907 13:99852843-99852865 GGTCAGATACAGATTAAGTCAGG - Intronic
1113126238 13:106982513-106982535 GGGCAGAGACAGAATCACTCCGG - Intergenic
1115361438 14:32507828-32507850 GGCAAGAACCAGAATGAGTCAGG + Intronic
1117111125 14:52455979-52456001 TGTCAGGAACAGACTGTGTCAGG - Intronic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1119542441 14:75449510-75449532 GGTGAGAAGCAGAATGCATCTGG - Intronic
1121984780 14:98494355-98494377 GTACAGAAATAGAATGTGTCAGG - Intergenic
1125109501 15:36014369-36014391 GCTCAGAAATAGAATGACTTTGG - Intergenic
1127838515 15:62810032-62810054 GGTAAGAAAGCGCATGAGTCAGG + Exonic
1128674686 15:69599997-69600019 GGACAGGAACAGAGTGAGACAGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1136098670 16:27977278-27977300 GGTCAGAAACGGAACAAGACAGG + Intronic
1137043508 16:35636539-35636561 GGTCAGCAGCAGAATGACTGGGG + Intergenic
1137782474 16:51109253-51109275 ACTCAGAAACAGAATGAGAGGGG - Intergenic
1140444384 16:75013321-75013343 GGACAGAAAAAGTAAGAGTCAGG - Intronic
1141187861 16:81800899-81800921 GGTCAGAGTCAGAGTGAGACTGG + Intronic
1141459345 16:84168245-84168267 CGTCAGAGTCAGAATGAGGCTGG - Intronic
1143004775 17:3822880-3822902 GGTAAGATGCAAAATGAGTCTGG + Intronic
1143910956 17:10248672-10248694 AGAAAGAAACAGGATGAGTCAGG + Intergenic
1146539749 17:33684115-33684137 AGTCAAAAACAGAAAGAGTATGG - Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146607404 17:34272503-34272525 GGTGAGAAAAAGAATGAGTTTGG - Intergenic
1147564143 17:41526397-41526419 GGTGAGAAAAAGAATGCGTAAGG + Intronic
1148238399 17:45984017-45984039 CGTCAGAAGCAGCAGGAGTCGGG - Intronic
1149189358 17:54040423-54040445 GGAAAGAAACAGGGTGAGTCTGG - Intergenic
1151218527 17:72593799-72593821 GGTCAGAAAAAGAAGGCATCAGG + Intergenic
1152001588 17:77649163-77649185 GGAAAGATACAAAATGAGTCTGG - Intergenic
1155846703 18:30716820-30716842 TGAGAGAAACAGAATTAGTCAGG - Intergenic
1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG + Intronic
1160247188 18:77168484-77168506 GGTCAGCAACAGACGGATTCTGG - Intergenic
1163525799 19:17820762-17820784 GGCCAGAAACAGAGTGAGGCAGG - Intronic
1164590341 19:29503461-29503483 GGTCTGGGACAGAATGTGTCTGG - Intergenic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1164793450 19:31007093-31007115 GGTGAGAAAAAGATTGAGTGAGG - Intergenic
1167024790 19:46907449-46907471 GCTAAGAAACAGAATGAATGGGG - Intergenic
1167291841 19:48629053-48629075 GGTCAGACACAGAACGATGCAGG - Exonic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
925234468 2:2265985-2266007 GGTTAGAAACAGAATAGCTCCGG + Intronic
928843613 2:35641657-35641679 GGTGAGAAACAGGATGAGCATGG + Intergenic
929263200 2:39889740-39889762 GATCAGAATCAGAATCAATCAGG - Intergenic
929907442 2:46058574-46058596 GGTGATATGCAGAATGAGTCTGG - Intronic
930847115 2:55918056-55918078 GGTCAGTAATAAAATAAGTCAGG + Intronic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
932708127 2:74042677-74042699 GGTAAGAACCACAAGGAGTCAGG - Intronic
934980852 2:98838809-98838831 GGTGAGAAAAACAATGAGACTGG + Intronic
939053403 2:137332986-137333008 AGTGAGCAACAGAATGAGTTAGG + Intronic
940039447 2:149344886-149344908 AGTCAGAAAGAGAAAGAGGCAGG + Intronic
942300914 2:174561539-174561561 GGTCAGAAATTGATTGAGTACGG - Exonic
946175142 2:217917971-217917993 CGGCTGAAACAGAATGAGTGAGG + Intronic
946360470 2:219216536-219216558 GGTCAGAAAGAGACTGTGGCTGG - Intronic
946859461 2:223986853-223986875 GGTCAGAAGCAGAAGGAGTGGGG - Intronic
948264941 2:236629263-236629285 GGTCAGAAACAGAGGGAGAGGGG - Intergenic
948323105 2:237086747-237086769 GGGCAGAATCAGAATGCTTCAGG + Intronic
1172875162 20:38159723-38159745 GGTCAGTCACACAGTGAGTCAGG - Intronic
1173500857 20:43552021-43552043 GGAAAGAAACAGAATGAATGGGG - Intronic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1175690191 20:61059683-61059705 GGTGAGAAACAGAAGGAGTAGGG - Intergenic
1178105895 21:29318800-29318822 CTTCAGAAAGAGAATGACTCTGG - Intronic
1178144150 21:29718529-29718551 GGTGAGAGACAGGATGAATCAGG + Intronic
1178870193 21:36367195-36367217 GTTTTGAAACAGAATGAGTAAGG + Intronic
1179594900 21:42436995-42437017 GGCCAACAGCAGAATGAGTCTGG - Intronic
1181329821 22:22081226-22081248 GGTCAGACACAGATGGACTCTGG - Intergenic
1181889036 22:26045382-26045404 TGACAGAAGCAGAATTAGTCAGG + Intergenic
1181935750 22:26437173-26437195 GGTCAGAAGCAGGATAAGCCTGG + Intronic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1183056746 22:35311439-35311461 GGACAGAACAAGAAAGAGTCTGG - Intronic
1183602431 22:38847731-38847753 GGCCAGAAACAGAATCGGGCAGG + Intergenic
949647417 3:6111975-6111997 GGCAAGAAACAGAAAAAGTCAGG - Intergenic
950907465 3:16552292-16552314 GGCCAGTAACATAATGATTCAGG - Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
955087283 3:55715553-55715575 GCTCAGAAACAGCATGTGCCTGG + Intronic
955318603 3:57958847-57958869 GGACAGAAAAAGAATGAGGAAGG - Intergenic
955891488 3:63654727-63654749 TGAAAGAAACAGAATGATTCTGG - Intronic
956028114 3:65005697-65005719 AGACAGATGCAGAATGAGTCAGG - Intergenic
958261909 3:91391859-91391881 GGTCAGAAATAGAATAGGTCAGG + Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
962152723 3:132909964-132909986 GGAAAGAAAAAGAATGTGTCTGG + Intergenic
963719195 3:148840504-148840526 GGTCAGTAACAGAATCTCTCTGG + Intronic
964822839 3:160792697-160792719 GGTCAGAAACATAGATAGTCTGG - Intronic
966636619 3:182141368-182141390 AGTCAGAAAGAGGAAGAGTCAGG - Intergenic
967855644 3:194115445-194115467 TGACAGAGACAGAATGAGTTGGG + Intergenic
968665839 4:1821987-1822009 GGTTAGGAAAAGAGTGAGTCCGG - Intronic
969155597 4:5206927-5206949 GGTCAAGAACAGGATGAGTCTGG - Intronic
972710441 4:41589710-41589732 GGTCAGACACAGAACGAGCGAGG - Intronic
973002058 4:44963265-44963287 GGCCAGAAAAAGAGTCAGTCAGG - Intergenic
974890540 4:67876976-67876998 GGTCAGAAAGAAAAAGAGTATGG - Intronic
975857795 4:78642878-78642900 GGTTAGAAAGATAATGAGTTTGG - Intergenic
978765459 4:112400785-112400807 TGCCAGCAACAGGATGAGTCTGG - Intronic
980778189 4:137463376-137463398 GGTTAGGAAAAAAATGAGTCAGG + Intergenic
982488799 4:156002207-156002229 GGTCAGAAACAGAACGTGGTGGG + Intergenic
982889310 4:160826595-160826617 GCACGGAATCAGAATGAGTCAGG + Intergenic
983357851 4:166687167-166687189 GGACAGAAACAGAAAGAGAGAGG - Intergenic
987956160 5:24743413-24743435 AATCAGAAACATAATGAATCTGG - Intergenic
988354480 5:30155586-30155608 GGTCAGAAACAGAAGGAGTGGGG - Intergenic
988657056 5:33223785-33223807 GGTCAGAAGCAAAGTGAGTCCGG - Intergenic
989199460 5:38749275-38749297 GGGCAGAACCAGACTGAGTTTGG + Intergenic
992197387 5:74353473-74353495 GTTAAGAAACAGAATAAGGCCGG - Intergenic
992731671 5:79676300-79676322 GGTCACAAAAAGAATGGGGCTGG + Intronic
994246276 5:97481352-97481374 GTTCAGATACAGAAGGAGTTTGG + Intergenic
995349981 5:111163986-111164008 GGAAACAAACAGAATGAGTCTGG + Intergenic
995598890 5:113775228-113775250 GGTCAGAAACATACTGGGTTGGG + Intergenic
997741700 5:136260549-136260571 GGGCTGAAACAGAGTGAGTGAGG + Intronic
997838096 5:137212929-137212951 GGTCAGCAGCAGCTTGAGTCTGG - Intronic
998045804 5:138985742-138985764 GGTCAGAGTCACACTGAGTCAGG + Intronic
998219204 5:140262389-140262411 AGCCAGAACCAGAATCAGTCAGG - Intronic
998362370 5:141600105-141600127 GGTCAGAGACACAAGGATTCAGG + Intronic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999446926 5:151647557-151647579 GCAGAGAAACAGAGTGAGTCAGG - Intergenic
1001818251 5:174689479-174689501 TGTCAGAAACAGACTCAGACGGG + Intergenic
1003431523 6:6043173-6043195 GGTCAGGATCTGAATGAGCCAGG + Intergenic
1003450124 6:6223040-6223062 AGCCAGAAACAGAATGAGAGTGG - Intronic
1006645292 6:35511334-35511356 GGTCAGAAACAGACAAGGTCAGG - Intronic
1008993252 6:57628280-57628302 GGTCAGAAATAGAATAGGTCAGG - Intronic
1009181861 6:60527369-60527391 GGTCAGAAATAGAATAGGTCAGG - Intergenic
1009526458 6:64752248-64752270 AATCAGAAAGAGAATGACTCAGG + Intronic
1009535142 6:64872756-64872778 GAACATAAACAGCATGAGTCAGG + Intronic
1010418519 6:75644026-75644048 GGTAAGACACAGAATGAGTATGG + Intronic
1010453884 6:76032793-76032815 GGTCAGAATCCGAGTGAGTAGGG + Intronic
1011563998 6:88655547-88655569 GGACAGAACCAGACTGAGGCAGG + Intronic
1012015130 6:93840576-93840598 GCTCAGAAACTGTATTAGTCAGG + Intergenic
1012917569 6:105186991-105187013 GGTTAGAAACAAATTTAGTCAGG - Intergenic
1015850550 6:137567590-137567612 AGGCAGAAACAGAAGGAATCAGG - Intergenic
1016250760 6:142039081-142039103 AGTGTGAAACAGAATGAGTCAGG + Intergenic
1017234801 6:152108290-152108312 GGTCAGCAACAGAACAAGGCAGG - Intronic
1017541818 6:155410846-155410868 GCACAGAAACAGAACCAGTCAGG + Intronic
1017611121 6:156187468-156187490 AGTTGGAAAGAGAATGAGTCAGG + Intergenic
1018181178 6:161225076-161225098 GGTAATAATCCGAATGAGTCAGG - Intronic
1018181196 6:161225191-161225213 GGACGGAATCAGAATGAGTCAGG - Intronic
1018213373 6:161503686-161503708 GGTCACAACCAGAAGCAGTCCGG + Intronic
1018699757 6:166416982-166417004 GGGCTGAAAGAGAAGGAGTCAGG - Intronic
1022290698 7:28999962-28999984 GGTGAGTAACAAAATGTGTCAGG + Intronic
1023116767 7:36870202-36870224 GGTCAGAAAGAGAAAGAATAAGG + Intronic
1027364964 7:77447786-77447808 GGACAGAAACAGGATGGGTGAGG + Intergenic
1028441638 7:90869759-90869781 GGGCAGGAACAGCATGAGACTGG + Intronic
1028679939 7:93515351-93515373 TGCCACAAACACAATGAGTCAGG - Intronic
1030424253 7:109353235-109353257 GGATAGAAACAGAATGAAGCTGG + Intergenic
1030758784 7:113324410-113324432 GAGCAGAAACACAATGAGACAGG - Intergenic
1030829725 7:114206343-114206365 GGTCAGAAACATAATATGTGAGG - Intronic
1031985826 7:128164167-128164189 GGAGAGAATCAGAATGACTCAGG - Intergenic
1032372252 7:131368548-131368570 GGAGAGAAAGAGAATGAGTGGGG + Intronic
1032826970 7:135580349-135580371 GGTGAGAAACAGAATTTGTACGG - Intronic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1034868919 7:154665530-154665552 GGGAAAATACAGAATGAGTCAGG - Intronic
1036344188 8:7946396-7946418 GGACAGAAACACCATGACTCAGG + Intronic
1036839531 8:12107167-12107189 GGACAGAAACACCATGACTCAGG + Intronic
1036861321 8:12353408-12353430 GGACAGAAACACCATGACTCAGG + Intergenic
1037002302 8:13734579-13734601 GGTCTGAAACAAAAAGAGTGGGG + Intergenic
1037894491 8:22642749-22642771 GGTCAGAGACAGCATGTGGCAGG + Intronic
1038330952 8:26608962-26608984 ACTCAGAAACACAATGAGTGAGG - Intronic
1038896412 8:31787522-31787544 GCTTAAAAACAGAATGAGTTTGG + Intronic
1040646253 8:49401079-49401101 TGTAAGGAACAGAATGAGGCCGG + Intergenic
1042981035 8:74528617-74528639 GATCAGACACATAATGAGTAGGG + Intergenic
1048647087 8:136433919-136433941 AGTCATAAAAAGAATGAGACTGG + Intergenic
1049009637 8:139879021-139879043 AGTCAGAGAAAGAATCAGTCAGG + Intronic
1050097582 9:2082988-2083010 GTTCAGAAAAAAGATGAGTCAGG - Intronic
1051491586 9:17672859-17672881 ATTCTGAAACAGAATGAGGCTGG - Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1055935547 9:81601203-81601225 GATCAGAAACAGAAAAAGTGGGG + Intronic
1057537748 9:95931223-95931245 GGGCAGAAACAGACTGAGAGGGG - Intronic
1058455045 9:105130870-105130892 GGGCAAAAAAAGAATGAGGCTGG + Intergenic
1058637086 9:107047725-107047747 GGGGAGAGACAGAATGAGGCCGG - Intergenic
1059802906 9:117768839-117768861 GATCAGAAACAGAAAGAATATGG + Intergenic
1186270031 X:7877154-7877176 GGTCAGAGAAAGCAGGAGTCCGG + Intergenic
1189319869 X:40081358-40081380 GGTAAGAAACAAAAAGAGACTGG + Intronic
1189685958 X:43563778-43563800 CTTATGAAACAGAATGAGTCTGG - Intergenic
1195465604 X:105175727-105175749 TGTCAGAATCAGAATAAGTGAGG - Intronic
1201253617 Y:12086107-12086129 GTTCAGAAACAGAGAGACTCTGG + Intergenic