ID: 1158467083

View in Genome Browser
Species Human (GRCh38)
Location 18:57700102-57700124
Sequence TTCTTAGCAGGGCTACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158467083_1158467089 6 Left 1158467083 18:57700102-57700124 CCTTCCAGTAGCCCTGCTAAGAA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1158467089 18:57700131-57700153 GGCCTATCCATTTGTCATTTCGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158467083 Original CRISPR TTCTTAGCAGGGCTACTGGA AGG (reversed) Intronic
904158049 1:28501301-28501323 TTCTTTGGAGGGCTAGTAGAAGG - Intergenic
906078973 1:43071249-43071271 TCCTCAGCAGGGCTGCAGGAAGG + Intergenic
906607025 1:47179857-47179879 TTCCTTGCAGGGCTGCTGGGAGG - Intergenic
915038412 1:152947569-152947591 TTCTGGGCAGAGCAACTGGAAGG + Intergenic
918975340 1:191476736-191476758 GACTTAGCAGTGCTACTGGTGGG - Intergenic
921757477 1:218875852-218875874 TTCTTAGCAAGGCAAAAGGAGGG + Intergenic
921983894 1:221287415-221287437 GTCTTAGTATGCCTACTGGAGGG + Intergenic
922452032 1:225745214-225745236 TTCTTGGAAGGGATACAGGATGG + Intergenic
922575458 1:226658361-226658383 TTCTAACCAGGGCTACAGGAGGG - Intronic
923566427 1:235079885-235079907 CTCTTGGCAGAGTTACTGGAAGG - Intergenic
923731199 1:236551998-236552020 TTCTTAGCAGAGTTGATGGAAGG - Exonic
924261620 1:242237485-242237507 TTCTTAGTAGGGGTGCTAGAGGG + Intronic
1064628300 10:17283632-17283654 TTCTTCGCAGGGCAGCAGGATGG - Intergenic
1065131194 10:22622034-22622056 ATCTTAGCAGAGCTTCTGGAAGG - Intronic
1065329513 10:24580005-24580027 TTCATAGCAGGGATGCTGGGAGG + Intergenic
1067051686 10:43025108-43025130 TGCACAGCAGGGCTAATGGACGG + Intergenic
1069159924 10:65080468-65080490 TTCTTCACAGGGCTGCAGGATGG - Intergenic
1070156159 10:73836831-73836853 TTCCCAGCAGGGCTCCTGGTGGG + Intronic
1072628635 10:97130730-97130752 TACTTCGTAGGGCTACTGGGAGG + Intronic
1073628131 10:105120199-105120221 TTCTTCACAGGGCGGCTGGAAGG - Intronic
1074773897 10:116752225-116752247 CTCTTGGCAGGGCTACTTGGTGG - Intergenic
1075316724 10:121459169-121459191 TTCTTGGCAGAGCTGATGGAAGG - Intergenic
1075615202 10:123885622-123885644 TTCTTTGGATGGCCACTGGAAGG - Intronic
1075888271 10:125921889-125921911 TTCTTTGCAGGGGTGGTGGAAGG - Intronic
1078942458 11:16023126-16023148 TTCTTCCCAGGGCTGGTGGAAGG - Intronic
1079106591 11:17576029-17576051 TTCTTCGCAGGGGTTCTGTAAGG - Intronic
1083144894 11:60750772-60750794 TACCTTACAGGGCTACTGGATGG + Intergenic
1084725444 11:70938879-70938901 TTCTTAGCGGGGCAGCTGCAGGG + Intronic
1090397105 11:126426064-126426086 TCCTTAGCAGAGCAACTGGCCGG - Intronic
1091193692 11:133714828-133714850 TTCTTAGGAGGGGCACTGGCTGG - Intergenic
1092300933 12:7249512-7249534 TTGTTTGAAGGGCTACTGGAGGG + Intergenic
1100406835 12:94279288-94279310 TTCTTTTCAGGGATAATGGAAGG - Intronic
1100891104 12:99126867-99126889 ATGTTAACAGGGCTAGTGGATGG + Intronic
1105570270 13:21596063-21596085 TTCTTAGCAACACTCCTGGAAGG - Intronic
1107723103 13:43270145-43270167 TTTTAAGCAGGGCCACTGTATGG + Intronic
1110204770 13:72899439-72899461 TTCATACCAGGGATGCTGGATGG + Intronic
1110820400 13:79908837-79908859 TTCATAGCAGAGCAACAGGAGGG + Intergenic
1111189440 13:84789319-84789341 TTCTTTGCAAGGCAACAGGAAGG - Intergenic
1111663490 13:91239483-91239505 TTCTTCGCAGGGCGGCAGGAAGG - Intergenic
1112770568 13:102790498-102790520 TTCTTACCAGGCCTTCTGGTGGG - Intronic
1112966226 13:105198616-105198638 TCCTTCACAGGGCTACTGGATGG + Intergenic
1113025467 13:105936519-105936541 TTCTTTGCAGGTCTACTGTGAGG - Intergenic
1113507700 13:110828446-110828468 TCCTTAGCAGTGTTAATGGATGG + Intergenic
1118717387 14:68569923-68569945 CTCATAGAAGGGCTACTGGAGGG + Intronic
1121543016 14:94742726-94742748 ATCCTTGCAGGGCTATTGGAAGG - Intergenic
1121682799 14:95808263-95808285 TTCTAGGCAGGGCTACTACATGG - Intergenic
1126153338 15:45542649-45542671 TTCTTCACAGGGCAACAGGATGG + Intergenic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1127614867 15:60674175-60674197 TTCTTGGCAAAGCTAATGGAAGG - Intronic
1127775536 15:62261626-62261648 TTCATAGCAGGGATATAGGATGG + Intergenic
1127869547 15:63059883-63059905 TTCTTCGCAGTGCTACTGATTGG - Intronic
1128509556 15:68304965-68304987 TTCTTAGCATAGCAACTAGAGGG + Intronic
1131717188 15:95124785-95124807 TTCTGAGAAGGACAACTGGAAGG + Intergenic
1131968523 15:97870209-97870231 TTCTAAGCAGGGCAACAGTAAGG - Intergenic
1133780998 16:8939229-8939251 GTCGTAACAGGGCCACTGGAGGG - Intronic
1136024988 16:27463388-27463410 TTCTTGGCAGGGGTACTTGGAGG - Intronic
1138483540 16:57320033-57320055 TGCTTAGCTGGGATACAGGAAGG - Intergenic
1139302817 16:65959890-65959912 TCCTTTGCAGGGCTTCTGGGAGG - Intergenic
1139312116 16:66036327-66036349 TACTTCGCAGGGTTGCTGGAAGG - Intergenic
1142191693 16:88721103-88721125 TTCTGAGTGGGGCTACTGCAGGG - Intronic
1143901292 17:10176660-10176682 TTCTCAGTAGGGCTGCTGCAGGG - Intronic
1144402693 17:14921547-14921569 TTATTAGAAGTGCTACTAGAGGG + Intergenic
1146721485 17:35127157-35127179 TTCTTTGCAGGGATGCTGGAGGG + Exonic
1147881390 17:43656380-43656402 TTCGTGGCAGGGGTAGTGGAGGG + Intronic
1148075166 17:44931617-44931639 TTCTCAGCACGGGAACTGGATGG - Exonic
1149649626 17:58268755-58268777 TTCTCAGAAGGGCCACTGGAAGG - Intergenic
1150010223 17:61496273-61496295 TGCTTAGCAGGTCTAATTGAAGG - Intergenic
1157298503 18:46462678-46462700 TCTTTGGCAGGGCTCCTGGACGG + Exonic
1158467083 18:57700102-57700124 TTCTTAGCAGGGCTACTGGAAGG - Intronic
1158531809 18:58269322-58269344 ATCTTTGCAAGGCTACTGAATGG + Intronic
1159105172 18:63996385-63996407 TTCTTACAGAGGCTACTGGAGGG + Intronic
1159395762 18:67853806-67853828 TTCTTTGCAGGGTTGCAGGATGG + Intergenic
1168400158 19:56080985-56081007 TGCTTAGCAGAGCCACTGGCAGG - Intergenic
925113804 2:1360434-1360456 TTCTAAGCTGTGCTGCTGGAAGG - Intronic
925313658 2:2905958-2905980 TACCTAGCAGGGTTCCTGGAAGG + Intergenic
925635948 2:5941571-5941593 TTCAAAGCTGGGCTGCTGGAGGG - Intergenic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
929476249 2:42252452-42252474 TTCTTCACATGGCTACTAGAGGG + Intronic
931341381 2:61404535-61404557 GTCTTAGCAGTGCTCCAGGAAGG - Intronic
931682163 2:64760055-64760077 TTTTTAACATGCCTACTGGAGGG - Intergenic
932289615 2:70565722-70565744 GTCTTAGCAGGTCTAATTGAGGG - Intergenic
933312301 2:80675959-80675981 TTCTGAGGAGGGCCAGTGGAGGG + Intergenic
934552431 2:95270611-95270633 TACTTAGGAGGGGTGCTGGAAGG + Intergenic
940258562 2:151757807-151757829 GTTTAAGCAGGGCCACTGGAGGG - Intergenic
942258483 2:174132241-174132263 TTCTTAGCAAGACTAGTGAACGG - Intronic
1169046305 20:2536856-2536878 CTCCTTGCAGGGCTACTGGAAGG + Intronic
1175149456 20:56921639-56921661 ATCTTAGCAGAGGTACGGGATGG - Intergenic
1175499299 20:59438496-59438518 TACAGAGCAGGGCTGCTGGAAGG - Intergenic
1178681850 21:34679231-34679253 TTCTTTGCATGGCAACAGGAAGG + Intronic
1179190861 21:39120817-39120839 TTCTCAGCAGGGCTTCAGCATGG + Intergenic
1184039676 22:41935422-41935444 GTCTTTGCAGGGTAACTGGAGGG - Intergenic
1185053296 22:48564893-48564915 TTTTTTGCAGGGCCACTGGGGGG - Intronic
949127533 3:464428-464450 TCATTCACAGGGCTACTGGAAGG + Intergenic
949794653 3:7835080-7835102 TTCTTAGCAGTGATACCGGGCGG - Intergenic
949929651 3:9068792-9068814 TTACTAGAAGGGCTCCTGGAAGG - Intronic
950594391 3:13965976-13965998 TTCTCAGCAGGGCAATAGGAAGG + Intronic
950767464 3:15283902-15283924 TTCTAAGCAGGGCTATGGGCTGG - Intronic
955451543 3:59073295-59073317 TTTTTAGCAGGTTTACTGGGTGG - Intergenic
956674575 3:71722136-71722158 TTCTGGGCTGGGCAACTGGAAGG + Intronic
960647060 3:119897515-119897537 TTCTTGGGAGAGCTACGGGAAGG + Intronic
961459050 3:127038804-127038826 CTCTGAGCAGGGCACCTGGATGG + Intergenic
962552686 3:136511125-136511147 TTCTTCACAGGGCAGCTGGATGG - Intronic
962904458 3:139789315-139789337 TTCATTGCTGGGCCACTGGAGGG + Intergenic
964740932 3:159965232-159965254 TTCTTAGGAAGGCTATTGGTGGG - Intergenic
965131914 3:164711694-164711716 TTCTTCACAGGGCAACAGGATGG - Intergenic
966414625 3:179676123-179676145 TTCTTCACAGGGCGGCTGGAAGG - Intronic
967969547 3:194988807-194988829 TTCTTTGTGGGGCTGCTGGAAGG + Intergenic
970234284 4:13943255-13943277 TTATTAGCAGGGGAAATGGATGG + Intergenic
975938132 4:79606819-79606841 TTCTCTGCAGTGCTACTTGAAGG + Intergenic
977505185 4:97893140-97893162 CTCATAGCAGGGGTACTGCATGG + Intronic
981076667 4:140599193-140599215 TTTTTAACAGGGCAACAGGAAGG + Intergenic
988634343 5:32966555-32966577 TTCTCAGCAGGGATCCTGAATGG - Intergenic
990441034 5:55845644-55845666 TTCTTCACAGGGCAACAGGATGG - Intergenic
993521743 5:88911301-88911323 TTCTTAGCAGTGGCACAGGAAGG - Intergenic
993538573 5:89119402-89119424 TTTTTAGCAAGGGAACTGGATGG + Intergenic
993719950 5:91312354-91312376 TTCTTGGCATGTCTGCTGGAAGG + Intergenic
995283335 5:110358903-110358925 TTCTTTCCAGGGCGACAGGAAGG - Intronic
995536612 5:113142970-113142992 TACTTTCCAGGGCTACTGTAAGG + Intronic
995896844 5:117022884-117022906 TGCTTAGCAGAGCGCCTGGAAGG - Intergenic
997248789 5:132373190-132373212 TTCTTAGAAGGGAAACTTGAGGG + Intronic
1001381431 5:171309016-171309038 TTATTAGCAGGGATAATGGGCGG - Intergenic
1003957146 6:11174516-11174538 TTCTTGGCTGGGCATCTGGATGG - Intergenic
1004644975 6:17552150-17552172 TTCTCAGAAGGGCCATTGGATGG - Intronic
1004745051 6:18501476-18501498 TTCTTAGAAGGGCCACTGGCAGG + Intergenic
1008591079 6:52994708-52994730 TTATTATCACGGCAACTGGAAGG + Intronic
1011477201 6:87759755-87759777 CTCTTAGTAGGGCTTCTGGTTGG + Intergenic
1011847319 6:91582257-91582279 TTTTTTGCATGGCTTCTGGAAGG - Intergenic
1014234113 6:118936097-118936119 TTCTTCACAGGGCTGCAGGAAGG + Intergenic
1014254915 6:119151237-119151259 TTCATAGCAGGGCTCCTTGGTGG + Intergenic
1014339756 6:120189946-120189968 TTCTTAGCAGGCCTGCAGGCTGG + Intergenic
1021639919 7:22727245-22727267 TTCATAGCTGGGCTCCTGGAGGG - Exonic
1024284753 7:47747471-47747493 CTCTTACCTGGGCTACTGCAAGG + Intronic
1026094154 7:67328386-67328408 TTCTTAGCAGTGGCACAGGAAGG + Intergenic
1036581883 8:10082446-10082468 TTCTTAGGAGGGCGAAAGGAAGG - Intronic
1038453803 8:27658357-27658379 TTCATAACAGGACTTCTGGAAGG + Intronic
1039086418 8:33784618-33784640 TTCTTAGCAGGGGTATAGTAGGG + Intergenic
1040927440 8:52699317-52699339 TTCCTCACAGGGCTACTGTAGGG + Intronic
1045744696 8:105404943-105404965 TGCTTAGCAGGGTTCTTGGAGGG - Intronic
1046329238 8:112693492-112693514 TTCTTATCAGGAATAGTGGATGG - Intronic
1046344482 8:112904519-112904541 TACTTAGGAGAGCTACTGGGAGG + Intronic
1047169629 8:122479232-122479254 TTCCCAGCAGAGCTGCTGGAAGG - Intergenic
1048778440 8:137974109-137974131 ATCTGAGCAGGGCTGTTGGAGGG - Intergenic
1052043469 9:23767912-23767934 GTCATAGCAGGGCTGCTGAAAGG + Intronic
1056719930 9:89062945-89062967 CTCATAGCTGGGCTGCTGGAGGG + Intronic
1057798453 9:98174700-98174722 TTCTTCACAGGGCTGCAGGAGGG - Intronic
1058189918 9:101900852-101900874 TACTTAGCAGGGCTCTTGTAAGG + Intergenic
1058739889 9:107932436-107932458 TTCTTAGCAGGTAACCTGGATGG - Intergenic
1059355757 9:113698181-113698203 TTATTAGCAAGGCTGCAGGAGGG - Intergenic
1187278810 X:17840433-17840455 ATCTTTGCAGGGCTACTGAAAGG + Intronic
1188422400 X:30006111-30006133 TTCTTAGTAGGAGAACTGGAAGG + Intergenic
1190471658 X:50786561-50786583 TTCTTAGCAGGGTAACTGCAAGG - Intronic
1192145727 X:68681102-68681124 GTCTTAGAAGGGTTGCTGGATGG - Intronic
1193792597 X:85833660-85833682 TTCTTCACAGGGCTGCAGGAAGG - Intergenic
1199300135 X:146204151-146204173 GGCTTAGCAGGGCTGATGGAAGG - Intergenic