ID: 1158467206

View in Genome Browser
Species Human (GRCh38)
Location 18:57701486-57701508
Sequence TAGTGGTTCTCTCTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158467201_1158467206 27 Left 1158467201 18:57701436-57701458 CCTGCAGAGTATATAGGAAAGGC 0: 1
1: 0
2: 2
3: 5
4: 78
Right 1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158467206 Original CRISPR TAGTGGTTCTCTCTAGCTTC TGG Intronic
902094340 1:13930334-13930356 TGGTGGTTCACCCTGGCTTCAGG - Intergenic
904525395 1:31129709-31129731 GAGTCATTCTCTCTAGCTCCAGG + Intergenic
904880531 1:33693219-33693241 TAGGGGTTCTTTATAGGTTCTGG - Intronic
907607166 1:55829613-55829635 TTGTGATTCTCTGTAACTTCAGG - Intergenic
908877099 1:68689927-68689949 TCGTGGTTATTTCCAGCTTCTGG + Intergenic
912276066 1:108260314-108260336 TAGTGGTTCTCTCTGTTTTTTGG + Intergenic
912292162 1:108434044-108434066 TAGTGGTTCTCTCTGTTTTTTGG - Intronic
912926035 1:113913698-113913720 TTTTGGTTCTCTTTAGCTTCTGG + Exonic
914778624 1:150762305-150762327 TAGTGGTTGTATATAGTTTCAGG - Intronic
916767244 1:167873232-167873254 TATTCCTTCTCTCTAGCTTCAGG + Intronic
918154760 1:181833814-181833836 TGGTGGGTCTCGCTGGCTTCAGG - Intergenic
919520945 1:198585657-198585679 AAGGGGTTCTCTCTATATTCTGG + Intergenic
921436037 1:215123331-215123353 AAGTGGTTATCTCTGGATTCTGG + Intronic
1067182178 10:43996564-43996586 TCGAGCTTCTCTCTAGTTTCTGG - Intergenic
1069043989 10:63723400-63723422 TAGTGGGTCTCTTTGGCTTCAGG + Intergenic
1074455674 10:113593378-113593400 TTGTGGTCCTCTCTAGTTCCAGG - Intronic
1074991705 10:118713838-118713860 CAGTGGTTCTCGCTAACTTTTGG + Intronic
1075457088 10:122591903-122591925 ACGTGGTCCTCTCTGGCTTCTGG - Intronic
1076154064 10:128189225-128189247 TAGAGGATCACTCTAGCTTCAGG + Intergenic
1076366436 10:129923909-129923931 TAGGAGTTCTCTCTATATTCTGG - Intronic
1077372268 11:2188661-2188683 TAGGGGTTCTCTGTGGGTTCCGG - Intergenic
1078763492 11:14271549-14271571 TCGTGGTTCTCTCCAGTTTCTGG + Intergenic
1079427721 11:20359517-20359539 TATAAGTTCCCTCTAGCTTCTGG + Intergenic
1081174236 11:39907063-39907085 TAATTGTTCTCTATGGCTTCTGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1087130283 11:94663625-94663647 AATTTGTTCTCTCTTGCTTCTGG - Intergenic
1087147152 11:94823584-94823606 AAGTGGGTCTGTATAGCTTCTGG - Intronic
1088055731 11:105574302-105574324 TTTTGGTTCTTTATAGCTTCAGG + Intergenic
1088424311 11:109685448-109685470 TCTTGCTTCTCCCTAGCTTCTGG - Intergenic
1089998897 11:122936010-122936032 TAGTGGTTATCTCTAGCAAGAGG + Intronic
1091898101 12:4120720-4120742 TCATGGATCTCTCTAGTTTCTGG - Intergenic
1094507237 12:31072393-31072415 TCGTGTATCTCACTAGCTTCAGG - Intergenic
1097737518 12:63198041-63198063 TATTGGTTCTCACTCTCTTCTGG - Intergenic
1100252497 12:92842234-92842256 TACTCCTTCTCTCTAGCTCCTGG - Intronic
1102910532 12:116710279-116710301 TAGTGGTTATCTCTAGGGGCTGG + Exonic
1106658638 13:31775139-31775161 TTGTGGTTATCTGTACCTTCTGG + Intronic
1107152732 13:37130658-37130680 TTGTGTTGCTCTCTAGCTTAAGG - Intergenic
1108854376 13:54775146-54775168 AAGTAGTTCTCTCTTTCTTCAGG + Intergenic
1112480836 13:99773869-99773891 TAGTGGTTGGCTGTAGCTTCTGG + Intronic
1114344978 14:21785090-21785112 TAGTCGTTCTTTCTATATTCTGG - Intergenic
1115046283 14:28998734-28998756 TATTGCTTCTGTTTAGCTTCAGG + Intergenic
1119304954 14:73600257-73600279 GAGTTGTTCTCTGTAGCTTTTGG + Intergenic
1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG + Intronic
1126039077 15:44573431-44573453 ATGTGGTTCTCTCAAGTTTCTGG - Intronic
1128693544 15:69743748-69743770 TTGTGATGCTCTCTTGCTTCCGG + Intergenic
1130890362 15:88128314-88128336 TAGTGTTTCTCACCTGCTTCAGG - Intronic
1131210894 15:90495501-90495523 CAGTGGTTATCTCTGGCTTGTGG - Intronic
1135342503 16:21661203-21661225 TAGTGGTTCTCTCAAGTTTATGG - Intergenic
1137981807 16:53076124-53076146 TAGGAGTTCTCTGTATCTTCTGG + Intronic
1138235068 16:55375211-55375233 TTTTTGTTCTCTCTAGTTTCAGG - Intergenic
1139846970 16:69928182-69928204 TTCTGGTTCCCTGTAGCTTCTGG + Intronic
1143380325 17:6491785-6491807 CAGTGGTTTTCTCTAGATGCTGG + Intronic
1151731304 17:75913104-75913126 AAGTGGTTCTCTCAAGACTCAGG + Intronic
1152818054 17:82420432-82420454 CCTTGCTTCTCTCTAGCTTCTGG - Intronic
1153558288 18:6341067-6341089 TAGTGAGACTCTCTAGATTCTGG - Intronic
1154111992 18:11578075-11578097 TTTTGGTTCTCTCTGGCTTTCGG - Intergenic
1154957750 18:21276014-21276036 TGGTGGTTCCGTTTAGCTTCAGG + Intronic
1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG + Intronic
1159755278 18:72356426-72356448 TACAGGTTCTCTCAAGCTTTTGG - Intergenic
926207677 2:10845772-10845794 TAGAGCTTCTCCCCAGCTTCAGG - Intergenic
926587648 2:14706101-14706123 TCATGGTTCTCTCCAGCTTCTGG + Intergenic
929467381 2:42157240-42157262 TGGTGGTTATCTCTGGGTTCTGG - Intergenic
929472217 2:42205731-42205753 TAGTGGTTGGCTATAGCTTATGG + Intronic
930496107 2:52146013-52146035 TGGTCTTTCTCTCTTGCTTCGGG - Intergenic
933473572 2:82759480-82759502 TAGTGTTTATCTCTAGATACTGG - Intergenic
935415558 2:102813705-102813727 TAGTGGTATTCTCCAGTTTCAGG + Intronic
937098126 2:119248828-119248850 AAGTGGTTCTCTCTGGTTTTTGG + Intronic
938908119 2:135858635-135858657 GTGTGGTTCTTTCTAGCTTTAGG - Intronic
940003133 2:148987094-148987116 AAGTGCTTCTTTCTGGCTTCTGG - Intronic
942446011 2:176079703-176079725 TTGTGGTTCTCCGTTGCTTCGGG + Exonic
943287988 2:186029463-186029485 TATTGGTTTTCTCTAGTTCCAGG - Intergenic
946772747 2:223106051-223106073 TAGTGGTTATCTAGAGCTTGGGG - Intronic
946936732 2:224729405-224729427 TAGTGATTCTCTCTGATTTCTGG + Intergenic
1169150095 20:3282803-3282825 GGGTGGTTCTCTCTCCCTTCAGG + Intronic
1169437843 20:5609732-5609754 TACTGGTTTTCTCTAGCTCTTGG + Intronic
1169833194 20:9848172-9848194 TAGGAGTTCTTTCTATCTTCTGG - Intergenic
1174756953 20:53168452-53168474 TAGATGTTATTTCTAGCTTCAGG - Intronic
1182497200 22:30717975-30717997 CAGTGGTTTTCTCTTGCTTGAGG + Intronic
1182901390 22:33901190-33901212 TTCTGGTTCTCACTAGCTTCTGG - Intronic
1184581692 22:45422342-45422364 TGGTGGTGCTTTCCAGCTTCTGG - Exonic
949626195 3:5869169-5869191 AAGTGCTTCTCTCTGGCTCCTGG - Intergenic
950033385 3:9866799-9866821 TCATGGTGCTCTCTACCTTCTGG - Exonic
950055024 3:10017579-10017601 TCATGGTGCTCTCTACCTTCTGG - Intergenic
951365166 3:21772347-21772369 TAGGAGTTCTCTCTATATTCTGG - Intronic
951409311 3:22342913-22342935 CAGTGGTAGCCTCTAGCTTCAGG + Intronic
951812380 3:26715007-26715029 AAGTGATCCTCACTAGCTTCTGG - Intergenic
953360146 3:42288706-42288728 TTCTGGTTCTCTGTAGGTTCAGG + Intergenic
956084042 3:65590776-65590798 TAGAGGCTCTGTCTAGATTCTGG - Intronic
956169296 3:66419974-66419996 TAGCGGGTCTCTCTGGCTGCTGG - Intronic
956995619 3:74824133-74824155 TAGTGAGTCTGTCTGGCTTCTGG + Intergenic
958147195 3:89640593-89640615 TAGTGACTTTCTCTAGCCTCAGG - Intergenic
958786208 3:98598838-98598860 TAGTGGTCCTGTCTACCTTATGG - Intergenic
960246158 3:115402722-115402744 AAGTGGCTCTCTTTAGCTTAAGG + Intergenic
966466858 3:180238747-180238769 TAGTGGTTTTCACTAGATTCTGG + Intergenic
966936644 3:184714483-184714505 GGGTGGCTCTCTCTACCTTCAGG - Intergenic
967520684 3:190428868-190428890 TAGTGTTTCTCTGGAGCCTCAGG - Exonic
969284240 4:6192728-6192750 TAGTGCTTGATTCTAGCTTCTGG + Intronic
971698665 4:29938676-29938698 TATTCTTACTCTCTAGCTTCTGG - Intergenic
972722972 4:41719355-41719377 TAGATGATCTCTCTAGCTGCAGG + Intergenic
974860082 4:67509885-67509907 TAGTTATTATCTATAGCTTCAGG + Intronic
975086170 4:70342379-70342401 TTGTGTTTCTTCCTAGCTTCTGG + Intergenic
977852956 4:101852435-101852457 GAGTGGTTCTTTCTGGCTTGTGG - Intronic
984644520 4:182205386-182205408 TAGAGCTTCTCTCTGTCTTCAGG + Intronic
987304171 5:16622252-16622274 TTGTGATTCTCTCTAAATTCAGG + Intergenic
987757883 5:22120457-22120479 TGGTGTTTCTCTCTTGCTTGTGG - Intronic
987828748 5:23068053-23068075 TAGTGTTTCTCACAAACTTCTGG + Intergenic
988429168 5:31099847-31099869 TAGTGGTTATTCCTAGATTCCGG + Intergenic
989251492 5:39320571-39320593 TTGTGTTTCTCTCTTCCTTCTGG - Intronic
991566713 5:68012391-68012413 TTGAAGTTCTCTCTAGGTTCAGG - Intergenic
992696207 5:79290380-79290402 TAGTGGTTTTCTCTAATTGCTGG - Intronic
993865073 5:93184666-93184688 TAGTGGTTCTCTCTATCTTTGGG - Intergenic
996442309 5:123505947-123505969 TTGTGAGGCTCTCTAGCTTCAGG - Intergenic
997463320 5:134070552-134070574 TAGTGGTTCTCTCTGGGTGCTGG - Intergenic
999535112 5:152507741-152507763 TTATGGTTCTGTCCAGCTTCAGG + Intergenic
999917731 5:156281750-156281772 CAGAGGTTAGCTCTAGCTTCAGG + Intronic
1004102720 6:12630953-12630975 TAGTGGTTATCTCTAGGTGCAGG - Intergenic
1005607755 6:27492372-27492394 ATGTTGTTCTCTCTAGCCTCTGG - Intergenic
1005880454 6:30054706-30054728 TAGTGGTTGCCTCTGGCTGCAGG + Intergenic
1006262968 6:32892476-32892498 TTATTGTTCTCTCCAGCTTCAGG - Intergenic
1006430860 6:33994957-33994979 TAGTCCTTCTTTCTAGCTGCTGG - Intergenic
1011402979 6:86984486-86984508 TGGTGGCTCTCTCTTGCTGCTGG - Intronic
1011535036 6:88367608-88367630 TACTGGTTCTTTCTTTCTTCTGG + Intergenic
1016137792 6:140567619-140567641 TAGGAGTTCTCTCTTGTTTCAGG + Intergenic
1020334337 7:7050869-7050891 TAGTGGCTCTCTTGAGCTGCTGG + Intergenic
1022440904 7:30432223-30432245 TAGGGGTTCTCTATATATTCTGG - Intronic
1023496855 7:40807146-40807168 TAATGATTCTCTCTAACTTCTGG - Intronic
1026792095 7:73340736-73340758 TGGTGGGTCGGTCTAGCTTCAGG - Exonic
1027146478 7:75698938-75698960 TAGTGGTTCTCTCTCTCTTAGGG + Intronic
1029306632 7:99624557-99624579 TAGTGGTTTTCTCTTGCGGCAGG + Intronic
1030208177 7:106970827-106970849 TGGTGGTTCTCTCTTGTTGCTGG - Intergenic
1030886721 7:114947605-114947627 AAATGGTTCTCCCCAGCTTCTGG - Intronic
1031478426 7:122250180-122250202 TAGAGGTTCTCTCTAGAATCTGG + Intergenic
1032368737 7:131325813-131325835 TCCTTGTTCTCTCTAGCCTCCGG - Intronic
1032529949 7:132611732-132611754 TACTGGTTCTCTCTCACTACAGG - Intronic
1035564748 8:634140-634162 TAGGAGTTCTCTATAGATTCTGG - Intronic
1037593339 8:20332025-20332047 TACTGTCTCTCTCTAGCTACTGG + Intergenic
1039715338 8:40102418-40102440 TAGTGGTTTTCTGTAGCCTAAGG - Intergenic
1041008425 8:53518105-53518127 TGCTGGTGCTTTCTAGCTTCAGG - Intergenic
1050792914 9:9496350-9496372 TAGGAGTTCTCTATAGATTCTGG - Intronic
1053826520 9:42030512-42030534 GACTGGTTCTCTCTAACTTAAGG + Intronic
1054604040 9:67156885-67156907 GACTGGTTCTCTCTAACTTAAGG - Intergenic
1055925072 9:81501624-81501646 AACTGGTACTGTCTAGCTTCAGG + Intergenic
1057853481 9:98583568-98583590 TAGTGTTTGTCTCTGGCCTCAGG + Intronic
1058665476 9:107310574-107310596 TAGTGGTTGTCTCTGGGTTAGGG + Intronic
1190572904 X:51802905-51802927 TAGTGATTCTCTCTCCCTGCCGG + Intergenic
1191141254 X:57118799-57118821 TAGTGTTTCTCTCCAGGTTATGG - Intronic
1192354116 X:70383866-70383888 TAGTGGTTCTCTAGGGCTTTGGG + Intronic
1194884751 X:99299840-99299862 TTATTTTTCTCTCTAGCTTCAGG - Intergenic
1195550559 X:106164762-106164784 GATTGGTTCTCTCAAACTTCAGG - Intergenic
1200024826 X:153249052-153249074 TAGTGCTTCTCCCTGGGTTCTGG - Intergenic
1201373886 Y:13295340-13295362 TAATGCTTCTCTGTAGCTGCGGG - Intronic
1201896174 Y:18994743-18994765 TGCTGCTGCTCTCTAGCTTCAGG - Intergenic