ID: 1158470799

View in Genome Browser
Species Human (GRCh38)
Location 18:57735192-57735214
Sequence AGCAAAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 7, 2: 6, 3: 139, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158470799_1158470806 23 Left 1158470799 18:57735192-57735214 CCGTCCACCACTGCTGTTTTGCT 0: 1
1: 7
2: 6
3: 139
4: 419
Right 1158470806 18:57735238-57735260 TTCCATCCCTCCAATCCAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 216
1158470799_1158470807 24 Left 1158470799 18:57735192-57735214 CCGTCCACCACTGCTGTTTTGCT 0: 1
1: 7
2: 6
3: 139
4: 419
Right 1158470807 18:57735239-57735261 TCCATCCCTCCAATCCAGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158470799 Original CRISPR AGCAAAACAGCAGTGGTGGA CGG (reversed) Intronic
900925077 1:5699967-5699989 AGAAAAATAACAGTGGGGGAAGG + Intergenic
902671822 1:17979959-17979981 AGCCAATCAGCAGTGGAGGCGGG + Intergenic
903662480 1:24986772-24986794 AGCAGAACAAAAGGGGTGGAGGG - Intergenic
903862638 1:26374188-26374210 AGCAAGACAGCAGGGGAGGCGGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909388138 1:75084156-75084178 AGCACAAGAGTAGTGGTGGGTGG - Intergenic
909865875 1:80670331-80670353 AGCAACAAAGTAATGGTGGATGG - Intergenic
910066198 1:83154209-83154231 AGCAAAACAAAAGAGGTGGTAGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910341817 1:86197124-86197146 TGCAAGGCATCAGTGGTGGAAGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
914289905 1:146263504-146263526 TGCAAAAAAGCAGTTCTGGAGGG + Intergenic
914550948 1:148714287-148714309 TGCAAAAAAGCAGTTCTGGAGGG + Intergenic
916273334 1:162967682-162967704 AGAAAAACAGGAATGTTGGATGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918536910 1:185584894-185584916 AGCCACACAGCGGTGGGGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919918960 1:202156940-202156962 AGCAAGAGAGCAGTGGAGGCGGG - Intronic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920595824 1:207268936-207268958 AGCAAATCAGCATTGATGGATGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921174593 1:212583177-212583199 AGCTAAAAAGCAGTGGAGGCAGG - Intronic
921277516 1:213534528-213534550 AGCAGAAGAGCAGTGGTTGAAGG - Intergenic
921279921 1:213556524-213556546 AGAAGAACAGAATTGGTGGATGG + Intergenic
921348506 1:214211733-214211755 AGAAAATCAGCAGTGGGGGTCGG + Intergenic
922188171 1:223294505-223294527 AGCACAGCAACAGTGGTAGAGGG - Intronic
922294961 1:224241881-224241903 AGAAAAACAGGTGTGGTGGCAGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923588350 1:235295932-235295954 GCCAAAACAGCAGTGCTGAAAGG + Intronic
924504232 1:244666217-244666239 GGTAAAACAGTGGTGGTGGAAGG - Intronic
1063845692 10:10124701-10124723 ATCAATACAGCAGAGGTGGCTGG - Intergenic
1063894270 10:10662712-10662734 AACAAACCAGCAATGGTGGAGGG + Intergenic
1065184475 10:23158593-23158615 AGCAAAGCAGCAGTGAATGAAGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069171179 10:65231371-65231393 AGCAAAACAGGACTTGTGCACGG - Intergenic
1069285859 10:66714587-66714609 CTCAAAAAAGCAGAGGTGGATGG - Intronic
1070205177 10:74251860-74251882 AGGAAAACAGCAGTAATGAATGG - Intronic
1070436742 10:76401277-76401299 AGCAAAACAGAAGTGGTTTGTGG + Intronic
1070948469 10:80412061-80412083 AGCAGAAGAACAGTGGTGGCAGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071830946 10:89371546-89371568 AGCAAACCACTAGTGATGGAGGG + Intronic
1072053270 10:91727737-91727759 ATCAAGGCAGTAGTGGTGGAGGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073592324 10:104769068-104769090 ATGAAAACAGGAGAGGTGGAAGG - Intronic
1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG + Intronic
1073799186 10:107022761-107022783 AACAACACAGCAGTGGTTCAGGG + Intronic
1074022650 10:109599870-109599892 AACAAACCAGCATTGGGGGAAGG + Intergenic
1074256566 10:111808322-111808344 AGCAGATCAGCAGTGGTGCCAGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075310324 10:121408260-121408282 TGCAATACAGCAGGGATGGATGG + Intergenic
1075871701 10:125775779-125775801 AGCAGAGCAGCAGTGTCGGACGG + Exonic
1076225967 10:128775672-128775694 ATCAAAACGGCAGTGGGGGTTGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077756296 11:5031569-5031591 TACAAAATAGTAGTGGTGGAGGG + Intergenic
1078181952 11:9019192-9019214 AGCAACACAGCTCTGGTGCATGG + Intergenic
1078187646 11:9065923-9065945 AACACCACATCAGTGGTGGATGG - Exonic
1079318082 11:19426743-19426765 GCCAAAACAGCAGTTGTGGGAGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080292020 11:30681522-30681544 AGCAAAACTGCAGATGAGGAGGG - Intergenic
1080583044 11:33658925-33658947 GGCACAGCAGCAGTGGTGGGGGG - Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081446921 11:43139694-43139716 AGGAAAACCGCAGTGGTTTAAGG - Intergenic
1082118437 11:48352593-48352615 TGCAAAACAGCAGAGGTGAGTGG - Intergenic
1082255889 11:50032703-50032725 TGCAAAACAGCAGAGGTGAGTGG + Intergenic
1083451933 11:62752132-62752154 GACAGAGCAGCAGTGGTGGAGGG - Exonic
1083616886 11:64030707-64030729 TACAAAACAGAAGTGGAGGAGGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087093614 11:94299796-94299818 AGCAAAACACCAGTGTTCTATGG - Intergenic
1087117602 11:94542127-94542149 AGAAAATCGGGAGTGGTGGAAGG + Intergenic
1088080780 11:105909952-105909974 AGCAAAACAGGAGTGGTTTTGGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089377961 11:118008164-118008186 AGCAAAACAACAGGTGTGGCCGG - Intergenic
1091070421 11:132557800-132557822 GGCAAAATAGCAGGGGTGGATGG + Intronic
1091677220 12:2500200-2500222 ACCAAAGCAGCAGTGTGGGACGG + Intronic
1091849901 12:3687141-3687163 AGAAAAACAGCCCTGGAGGAGGG + Intronic
1091896577 12:4109968-4109990 AACAAAACAGCTGTGGTTGTGGG - Intergenic
1092857270 12:12685713-12685735 AGGAAAGAAGCAGTGGAGGATGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094506416 12:31065160-31065182 AGCAAACAAGCAGTTCTGGAGGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094685269 12:32706417-32706439 AGCAAAACAGCTGTGTTTGGAGG + Intronic
1095687655 12:45053296-45053318 AGCAACACAATAGTAGTGGAGGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096686777 12:53293197-53293219 AGGAAAACACCATTGGTGGTGGG - Intronic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098068668 12:66648082-66648104 AGCAAGAAGGCACTGGTGGAGGG - Intronic
1098077946 12:66753447-66753469 AGCAGGTCAGCAGTGGTGGAAGG - Intronic
1098146636 12:67504214-67504236 GTCAAAACAACAGTGGAGGAGGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099411044 12:82328639-82328661 AGCATAAAAGAAGTTGTGGAAGG + Intronic
1100420962 12:94433063-94433085 AGAAGAACATTAGTGGTGGAGGG + Intronic
1101832781 12:108272282-108272304 AGCAGAACAGAATTGGGGGAGGG + Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104874191 12:132021554-132021576 AGCAGAAAAGCAGAGCTGGATGG - Intronic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1107351925 13:39523720-39523742 AGCAGAGCAGTAGTGGTGGTAGG - Intronic
1107527477 13:41247637-41247659 AGCAATACTGCAGTTCTGGAGGG - Intronic
1107574303 13:41700838-41700860 ATAAAAACAGAAGTGGTGGCTGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108405667 13:50099553-50099575 AACAAAACAGCTGTGGTTGTGGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109198513 13:59405891-59405913 CCCAAAGCAGCAGTGTTGGAAGG + Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110709714 13:78636877-78636899 AGCCATACAGTAGTGGTGGGGGG - Intronic
1110808804 13:79789589-79789611 AGCCAAACAGCAGAGATAGAAGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111383300 13:87488969-87488991 AGCAAAACAACAGAGTTAGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1114147631 14:19995340-19995362 AGGAAAACAGTCATGGTGGAAGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114404098 14:22438883-22438905 ACAAAAACAGCATTGGTGAAAGG + Intergenic
1114479366 14:23022620-23022642 CGCAAAACAGCAGAGGTGCTTGG + Intronic
1115067022 14:29275747-29275769 AATAAAACAGCAGAAGTGGAGGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117996756 14:61485018-61485040 AGCCAAACAGAAGTGGAGGCCGG - Intronic
1118003773 14:61547102-61547124 TTCGAAACAGCAGTGGTGGGGGG + Intronic
1118434152 14:65754173-65754195 AGCAAAACAGAACTCATGGATGG + Intergenic
1118944623 14:70372921-70372943 GGCAGAATAGCAGGGGTGGAGGG + Exonic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1122415539 14:101547955-101547977 AGGAAAACAGCGATGGTGGGGGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123821064 15:24030952-24030974 AGTAGACCATCAGTGGTGGAAGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124015816 15:25874291-25874313 AGCAAAACAACAGAGATGGAGGG + Intergenic
1124190640 15:27573846-27573868 AGCAGAACAGCAGTGCAGCATGG - Intergenic
1126103472 15:45133620-45133642 AGCCAAAAAGCAGTGGAGCAGGG - Intronic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127291998 15:57579515-57579537 GGCACAACAGCAGTGATGGGAGG + Intergenic
1127730617 15:61798689-61798711 AGCAACACAGCAACCGTGGAAGG + Intergenic
1128330905 15:66754975-66754997 AGCAAATAAGCAGTAGAGGAGGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130113754 15:80988695-80988717 AACAAAACATCAGTGTTGGAAGG + Intronic
1131148643 15:90033055-90033077 TGCAGAACAGCACTGGTGCATGG - Intronic
1131542736 15:93288529-93288551 AGCGAGACAGCCGTGGGGGAAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132100808 15:99021672-99021694 AGGAGAAGAGCAGTGGTGGGTGG - Intergenic
1132217419 15:100075808-100075830 AGAAAAACAGCAGTGGAAAATGG - Intronic
1133725282 16:8531529-8531551 AGCAAGATAGCAGAGGTAGAAGG + Intergenic
1134391362 16:13823256-13823278 AACATAACAGCAGTGGTAGAAGG + Intergenic
1135076259 16:19396322-19396344 AGGAAAACATGTGTGGTGGAAGG - Intergenic
1135479005 16:22805259-22805281 AGCAAAATTGCAGTTGGGGAGGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1137299955 16:47139379-47139401 AGGAAAATAACAGTGGTGGCAGG - Intronic
1137928807 16:52567121-52567143 ACCAAAACAGAAGTGGGGAAAGG + Intergenic
1138153921 16:54685673-54685695 AAGAAGACAGCAGTGGTGCAGGG - Intergenic
1138365481 16:56472895-56472917 AGCAAAACTGCTTTGGTGGAAGG - Intronic
1139106134 16:63828988-63829010 AGTAAAACAACAATTGTGGATGG - Intergenic
1140087647 16:71810883-71810905 AGCAGAACCCCAGTGGAGGAGGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142541906 17:666311-666333 AGCCAAACAGAAGTGTTTGAAGG + Intronic
1143755697 17:9065678-9065700 AGTAAAACGGCAGTGGATGAAGG + Intronic
1147891843 17:43722940-43722962 AGCAAAACAGGAGGGGTTGGAGG - Intergenic
1147968682 17:44207830-44207852 AGCAGAGCAGCAGTGGGGTAGGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148790347 17:50169182-50169204 AGCAAGACAGAAGTGGAGGCTGG - Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149402531 17:56312859-56312881 AGAAAAACAACAGTGGGGGCGGG + Intronic
1151023214 17:70643898-70643920 AGCAAAATAGCATTTGTTGATGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152590857 17:81211300-81211322 AGCACAACAGCAGGAGAGGAAGG + Intronic
1153213156 18:2790247-2790269 AGCAAAACTGCAGGGGAGGGGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154977824 18:21476083-21476105 AGCAAATCAGCAGGGGTCGGGGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156902202 18:42312979-42313001 AGTAACACAGCAGTGGAGCATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158080884 18:53589350-53589372 AGGAAAACAAGAATGGTGGAAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158998582 18:62949650-62949672 AGCAAAACTGGACTGGTGGTAGG - Intronic
1159557029 18:69956209-69956231 AGCACAAAAACAGCGGTGGATGG - Intronic
1159967815 18:74613422-74613444 AGAAAAACAGCAGTGCTGTTTGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160222918 18:76990286-76990308 AGCAAAGCAGCAGGTGAGGATGG + Intronic
1162217430 19:9148019-9148041 AGCAAGACAGCAGGGTTGGGAGG - Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164680170 19:30129254-30129276 AGCAAGACAGGAGTGCTGAACGG + Intergenic
1165445569 19:35855315-35855337 AGGAAAACAGCCAAGGTGGAGGG - Intronic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1167497785 19:49829697-49829719 AGCCACACAGCAGTTGTGGTAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925359457 2:3267322-3267344 AGCAACACTGCAGTGTTGGTGGG + Intronic
925452516 2:3981784-3981806 GTCAAAACAGCTGTGGTGGGTGG - Intergenic
925554232 2:5111545-5111567 TGAAAAAAAGCAATGGTGGAGGG - Intergenic
926625908 2:15089553-15089575 AGCAAAACAGGGGTGGAGGCGGG + Intergenic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
926884897 2:17588022-17588044 CACAAAACAGGACTGGTGGAAGG - Intronic
927216259 2:20669307-20669329 AGCAAATCCCCAGTGGTGGGGGG + Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927897895 2:26796646-26796668 AGCAGAGCAGCAGTGGGGGTGGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929875719 2:45794855-45794877 AGAAAAAAAGAAATGGTGGATGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931446898 2:62334247-62334269 AGAATAACAACAGTGTTGGATGG - Intergenic
931476309 2:62591108-62591130 AGCAAAAAAGAGTTGGTGGATGG - Intergenic
932130339 2:69181735-69181757 AGCAAAACAGCACTGCTGTGTGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933419529 2:82028504-82028526 AGGAAAACATGTGTGGTGGAAGG + Intergenic
933911496 2:86944551-86944573 AACAAAACAGCAGGTGTGGTGGG - Intronic
934727114 2:96629700-96629722 ATCAAAACAGCAGCTGTTGAGGG - Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937821783 2:126318590-126318612 AGCAAAATAGGAGTGGTGCTGGG - Intergenic
937857804 2:126685294-126685316 AGCCAGACAGCAATGGGGGAAGG - Intronic
937914080 2:127090404-127090426 AGCACAACTGAAGTGGTGGAGGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940303622 2:152202104-152202126 AGCAAAAGATCAGTGGTTGTTGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940775610 2:157880454-157880476 AGAAAAACAGCAAAGGTTGAGGG + Intronic
941934121 2:170970100-170970122 AGCAAAAGAGCAGAGGAGTAAGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943136065 2:183914404-183914426 AGAAAAACAGCAATGGGGAAAGG - Intergenic
944213478 2:197230728-197230750 AGCAAACTGGCACTGGTGGAGGG + Intronic
944425376 2:199576641-199576663 AGGAAGAAAGGAGTGGTGGATGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945394995 2:209306584-209306606 AACAAACCAGCAGTGGTGGATGG - Intergenic
946098954 2:217302290-217302312 CCCAAAACAGCAGGGGTGGGGGG + Intronic
946169214 2:217884534-217884556 GGCAGAAGAGCAGTAGTGGAGGG - Intronic
947196542 2:227573675-227573697 AACAAAAGAGAAGTGGTGCAAGG + Intergenic
947302340 2:228702109-228702131 AGCAAGACAGCAGGGGCTGATGG - Intergenic
948129756 2:235591857-235591879 AGCAAGAGAGAAGTGGTGGGGGG - Intronic
948654538 2:239468661-239468683 AGCAGTGCAGCAGTGGTGGCTGG + Intergenic
1168908550 20:1426574-1426596 GGCAGAGCAGCAGTGATGGAAGG + Intergenic
1168912328 20:1458920-1458942 AGAAAAAAAGCAGTGTTGTATGG + Intronic
1170381451 20:15764450-15764472 GGCAAAACAGGTTTGGTGGAAGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172923449 20:38507808-38507830 ATCAAAACAGCAGGGGAAGATGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173031438 20:39364890-39364912 AACAAAATAGAAGAGGTGGAAGG + Intergenic
1174106714 20:48167555-48167577 AGCAAAACATCAGCAGTGCAAGG - Intergenic
1174477382 20:50805636-50805658 AGAAAAACAGCAGTGCAGGTGGG - Intronic
1175601941 20:60281378-60281400 AGCAAGTCAGCAGGGCTGGAAGG - Intergenic
1175617856 20:60417922-60417944 AGCAACACAACAATGGTGGGGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178761268 21:35405072-35405094 AGCCAAACAGAAGTGGGGCAGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179465211 21:41567363-41567385 AGCAAAACAGAATGGATGGATGG + Intergenic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1180053539 21:45344969-45344991 AGCCAAGCAGCTGTGGTTGACGG + Intergenic
1182098563 22:27642154-27642176 AGGAACACAGCAGGGGTCGAGGG + Intergenic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182934200 22:34205737-34205759 AGAAAAAAAGGAATGGTGGAGGG + Intergenic
1183013237 22:34964805-34964827 ATAAAAACACCAGTGGTAGAAGG + Intergenic
1183253559 22:36746465-36746487 ATAACAACAGCAATGGTGGAGGG + Intergenic
1184875998 22:47275985-47276007 ACCAAAACAGCAGTGGAGAGAGG - Intergenic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
949405811 3:3713366-3713388 AGCAAAACAGGAGGGGGTGATGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949874784 3:8619040-8619062 AACAAACCAGCTGTGTTGGATGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955439038 3:58935654-58935676 AGAAAAACAGCAATGGGGAAAGG + Intronic
956044045 3:65176266-65176288 AGAAACTCAGCAGTGGTGTATGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957034656 3:75282634-75282656 TGCAATACAGCAATGGTGGGAGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959135065 3:102408170-102408192 AGGAAAACAACATTGGTGTAAGG - Intronic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959432113 3:106267686-106267708 AACAAAACATCAGTTGTGGCAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960088077 3:113611844-113611866 AGCCAAATAGCAATGGTGAAGGG - Intronic
960844289 3:121992761-121992783 AGCAAAGCAGCTGTGAAGGAAGG + Intronic
961902992 3:130232648-130232670 AGCGACACAACAGTGGTAGAGGG - Intergenic
962200145 3:133394299-133394321 ATCAACACAGCAGTGGGGGCAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963743875 3:149106833-149106855 AGCAAAACAACAATTGTAGATGG + Intergenic
964380791 3:156097197-156097219 AGCAAAAGAGAAGTCCTGGAGGG + Intronic
966247207 3:177822762-177822784 AGCAAAACAGCAGTGAATGATGG - Intergenic
967043160 3:185712635-185712657 AGCAAAACAGAACTGTTGCAAGG + Intronic
967648797 3:191960268-191960290 AGTAAAACAGCAGTGCAGGGAGG + Intergenic
968321786 3:197775989-197776011 AACAAAGGAGCAGAGGTGGAGGG + Intronic
968623751 4:1616634-1616656 TGCAAACCAGAAGTGGTTGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969293162 4:6253326-6253348 AGCAAAAAAACAGTGGAGGTGGG + Intergenic
971652350 4:29294490-29294512 AGCAAATCAGCAGTCCTTGAAGG - Intergenic
971871895 4:32251859-32251881 AGCAAAATAGGGGTGGTAGACGG + Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972723442 4:41724028-41724050 AAAAAAGGAGCAGTGGTGGAGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975322197 4:73021247-73021269 GGCTAAAAAGCAGTGCTGGAAGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975676248 4:76830766-76830788 AGGAAAGGAGCTGTGGTGGAAGG + Intergenic
976074791 4:81285264-81285286 AGTAAATCAGTAGTGCTGGAGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977411627 4:96673607-96673629 AGAAAAACAGCACTGTAGGAAGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977738317 4:100444694-100444716 AACAAAACATCAGGGATGGAGGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980257689 4:130403179-130403201 AGCAAAGCAATGGTGGTGGAGGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984009168 4:174349652-174349674 AGCAAAATACCAATGGAGGACGG - Intergenic
984036285 4:174672259-174672281 AGAAAAACAAGAGGGGTGGAAGG - Intronic
984579698 4:181497589-181497611 AGCAAAACAAAAATGGAGGAAGG + Intergenic
986215428 5:5714986-5715008 AGCCAGACAGCAGTTGAGGAGGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986639943 5:9862406-9862428 AGAAAAGCAGCCGTGGAGGAAGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987204007 5:15606370-15606392 AGCAAGACAGCAGCTGTGGTGGG + Intronic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988246669 5:28692610-28692632 AGGAAAAAAGTAGAGGTGGATGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989398392 5:40982774-40982796 AACAAAACAGCAGCTGTGGGAGG + Exonic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990278032 5:54220308-54220330 AACAAAACAGAGGTGGGGGAGGG - Intronic
990879941 5:60528040-60528062 ATCAAAACAGCATTGTTTGAAGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993374976 5:87140169-87140191 AGGAAAATAGAAGTGGTGTAGGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993665297 5:90688276-90688298 AGAAAAACAGCAATGGGGAAAGG + Intronic
993806809 5:92420568-92420590 AGGAAAACAGCAGTTAGGGAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994296872 5:98100718-98100740 ATCAAGAAATCAGTGGTGGATGG - Intergenic
994622139 5:102176453-102176475 AGCAAAACAATGGTGGAGGATGG - Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995881150 5:116845905-116845927 AGCAGAATAACATTGGTGGAGGG + Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
998037862 5:138932021-138932043 AGAAAAAAAGCAGTTGGGGATGG - Intronic
998837634 5:146218352-146218374 AGGAAAAGAGAAGTGGTGAAAGG - Intronic
1000393672 5:160750595-160750617 AGCCAAACAGTGATGGTGGAGGG - Intronic
1000597243 5:163230116-163230138 AGAAGAGCTGCAGTGGTGGAGGG - Intergenic
1001836976 5:174840833-174840855 AGCAAAACAGCAGTGGCTTTGGG + Intergenic
1001901821 5:175437299-175437321 AGCAAAATGGTAGTGGTGGTGGG - Intergenic
1001995359 5:176153038-176153060 TGCAAACTAGCATTGGTGGATGG - Intergenic
1002839717 6:895346-895368 AACAAAACAGCATTTGTGAAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004304292 6:14486681-14486703 CGTAAAACAGCACTGGTAGATGG - Intergenic
1004398661 6:15268687-15268709 TACAAAACAGCAGGGGAGGATGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005841296 6:29746041-29746063 AGCATGAAGGCAGTGGTGGAAGG + Intergenic
1005870762 6:29972777-29972799 AGCACGAAGGCAGTGGTGGAAGG + Intergenic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007277486 6:40685889-40685911 ACCATACCAGCACTGGTGGAAGG + Intergenic
1007598574 6:43067121-43067143 GCCAAAACAGCAATGGTGGGGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009765687 6:68072057-68072079 TGCAAAACACCAGTAGTGGAGGG + Intergenic
1010103330 6:72137303-72137325 AGCAATTCAGCAGTGTTTGAAGG + Intronic
1011482584 6:87809919-87809941 AGCAAAACAGCAATTGTGTGAGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011560565 6:88609610-88609632 AACAAAATGGCAGGGGTGGATGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG + Intronic
1013866317 6:114701070-114701092 AGCACAAGAGCAGTGGTAAAGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016485610 6:144534899-144534921 AGTAAAACAGCAGAGGTGGGAGG + Intronic
1017022457 6:150151562-150151584 ACAATAGCAGCAGTGGTGGAGGG - Intronic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018614150 6:165670096-165670118 AGCCACACACCAATGGTGGACGG + Intronic
1018786973 6:167116095-167116117 AGCACACCAGCAGGCGTGGATGG + Intergenic
1019049972 6:169175166-169175188 AGCAGCAGAGCAGGGGTGGAAGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1020993533 7:15232495-15232517 ATCAAATTAGCAGTGGTGCAAGG - Intronic
1021421768 7:20453701-20453723 AGCAGAACAGCAGCAGTGAAAGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022048973 7:26646588-26646610 ATCAAAACAGCAGCAGAGGAAGG + Exonic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022891697 7:34707716-34707738 AGCAATGCAGCAGTGGTAGAGGG + Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023940257 7:44764939-44764961 AGCAAGACAGCTTTGCTGGAGGG + Exonic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024340775 7:48256754-48256776 AGCAAAAGAGCAATGCTGTAGGG - Intronic
1024626451 7:51211983-51212005 ATCAAGAGAGCAGGGGTGGAGGG + Intronic
1025604203 7:63027300-63027322 AGCACAACTGCATTGGAGGATGG - Intergenic
1026207351 7:68269644-68269666 AGCAAGTGGGCAGTGGTGGAGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026550425 7:71363759-71363781 AGCAAAAGGAGAGTGGTGGACGG + Intronic
1026957605 7:74387571-74387593 ACCAGAACACCAGTGGTGGTGGG + Intronic
1027261697 7:76469252-76469274 AGCTAAACTGCAATGGTGGCTGG - Intronic
1027277912 7:76580570-76580592 AGCAAAACAAAAGAGGTGGTAGG + Intergenic
1027313079 7:76967362-76967384 AGCTAAACTGCAATGGTGGCTGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028180793 7:87721289-87721311 AGCCAGAAAGCAGAGGTGGATGG + Intronic
1028452127 7:90997177-90997199 AGCAAAACAGCTGCAGTGCAAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029673523 7:102050293-102050315 GGCATAAAAGCAGTGCTGGATGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030353706 7:108520176-108520198 AGCAAACCGGCAGAGGTGGAAGG + Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031259386 7:119498202-119498224 AGCCAGAGAGCAGAGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031992957 7:128209761-128209783 AGCCAGACAGCAGTGGGAGAAGG + Intergenic
1032347329 7:131128389-131128411 AGCAAAAAAGCAATGGTTTATGG + Intronic
1033552374 7:142459126-142459148 AGGAAATAAGCAATGGTGGAGGG - Intergenic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034837126 7:154362921-154362943 TGCAAAACTGCAGTGATGGTTGG - Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035331280 7:158098819-158098841 AGCAAGGAAGCAGTGGGGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037500283 8:19478710-19478732 AGCAATTCAGCAGTGGAGAAAGG - Intronic
1037773448 8:21817090-21817112 ACCTGAACAGCAGTGGAGGAGGG - Intergenic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1038698402 8:29826860-29826882 AGCAGAAATGCAGTGGTGGAAGG + Intergenic
1038855496 8:31327387-31327409 AGAAAAACAGCAATGGGGAAAGG + Intergenic
1039302295 8:36222398-36222420 AGCAAACCATCAGTGGTGAAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040404384 8:47086062-47086084 AGCAAGACAGCTGGGGTGGGGGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1040830485 8:51671295-51671317 AGAAAAACAGCAGTTGTGCATGG + Intronic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043514182 8:80981085-80981107 AGCATAAAATCAGTGGGGGAAGG - Intronic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1043930830 8:86089888-86089910 AGAAAAACTTCAGTAGTGGAGGG + Intronic
1044000150 8:86869470-86869492 AACAAGATAGCAGTGGAGGAGGG - Intronic
1044711533 8:95063304-95063326 AGGAAAACAGTATTTGTGGAGGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045255771 8:100519646-100519668 ACCAAAACAGCAGCAGTGGCAGG + Intronic
1045365288 8:101470328-101470350 ACCAACACAGCTTTGGTGGATGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046375651 8:113376897-113376919 AACAAAACAGCCGTGGTTGTGGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048086366 8:131185256-131185278 AGCAAAAGAGAAGTAGGGGAGGG - Intergenic
1048405529 8:134115922-134115944 AGCAAAACGACAGTTGTTGATGG - Intergenic
1049102770 8:140590958-140590980 AGCCAGGGAGCAGTGGTGGATGG - Intronic
1049300332 8:141866353-141866375 AGCAAGAGAGCAATGGGGGAGGG + Intergenic
1049876923 8:145029970-145029992 AGGAAAACATGTGTGGTGGAAGG + Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051715771 9:19981946-19981968 AGCCCAACATCAGTGGAGGAGGG + Intergenic
1053020913 9:34693332-34693354 AGCAACTGATCAGTGGTGGAAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053354829 9:37436781-37436803 AGCCAAACAGTAGAGATGGAGGG + Exonic
1053904928 9:42832232-42832254 AGCAAAAATGAAGTGGTTGAAGG + Intergenic
1055352095 9:75400020-75400042 CACAAAACAGCACTGGGGGATGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056116857 9:83449054-83449076 AGCAAAACAGCATTCACGGAGGG + Intronic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1059679154 9:116569500-116569522 AGATAAACAGCAGAGCTGGAAGG - Intronic
1059724680 9:116994996-116995018 AGAAAAACAGAAGTGTAGGAAGG + Intronic
1059766313 9:117386943-117386965 AGCAGAACAGCAGTGGGTTAGGG + Intronic
1060381366 9:123176533-123176555 AGTAAAACAGGAGTGGAGAAAGG + Intronic
1060778112 9:126391573-126391595 AGCAAAACTGCAGGGGTGGGAGG + Intronic
1187308674 X:18120355-18120377 AGCATTACGGCAGTGGGGGAGGG - Intergenic
1187621734 X:21063286-21063308 AGCAAAACCTCAGAGATGGAGGG + Intergenic
1187630977 X:21171917-21171939 AGTAAGACAGCAGTAATGGAGGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188170254 X:26915744-26915766 ATCAAAACAGCAGTATTTGAAGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188518494 X:31012763-31012785 AGCCAGATAGAAGTGGTGGAGGG - Intergenic
1188638590 X:32468044-32468066 AGCAAAACAGCAGAAATGAAAGG + Intronic
1189032949 X:37468287-37468309 AGCAAGACAGGAGTGTTGTAGGG - Intronic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190783925 X:53625554-53625576 ATCAAAACAGCCATGTTGGAGGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191661504 X:63656344-63656366 AGAAAAACAGAAGTTGTAGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194465344 X:94228382-94228404 AGCAAGACAACAGTGGAGGGAGG + Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197699742 X:129590074-129590096 AGCAAAACCTCAGGGCTGGAGGG - Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198074139 X:133178730-133178752 GGCAAAAGAGCAGTAGAGGAGGG - Intergenic
1198915806 X:141670393-141670415 AGAAAAACATCTGTGGAGGATGG - Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199985809 X:152949307-152949329 AGCAAAACAGCAGTGTGCCAGGG - Intronic
1201725695 Y:17149114-17149136 ATGAAAACAGCAATGCTGGAAGG + Intergenic
1202079340 Y:21068481-21068503 AGAAAAACAGCAATGGGGAAAGG + Intergenic